Homo sapiens
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA93339 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:More than 40% of patients with AML have a normal karyotype and are included in the intermediate prognostic group, in which risk classification is currently poor defined and more molecular markers are needed to achieve treatment stratification. EVI1 overexpression (OE) has been reported to discriminate in this group those with a worse prognosis. The EVI1 mice homolog has a role in the HSC proliferation through Gata2 expression, therefore, GATA2, a transcription factor with a relevant role in hematopoiesis, could be a candidate gene in the leukemogenic transformation in AML in patients with normal karyotype, and in other subgroups. GATA2 OE was detected in 46% of cases with normal karyotype, and was more frequent among samples with FLT3-ITD (p=0.0021), especially among the AML-M1 cases. We found a mutational pattern FLT3-ITD/GATA2-OE/WT1-OE that could define a subgroup of patients with normal karyotype and AML-M1, with a different gene expression array pattern and a poor prognosis. Our results show that GATA2 OE is a common event in AML cases with normal karyotype (46%). The deregulation of the expression of the GATA2 transcription factor would lead to a hematopoietic differentiation impairs, focusing GATA2 as a candidate gene that fits in the cooperating model for the multistep pathogenesis that causes AML transformation. Keywords: Disease state analysis
2005-10-27 | GSE3505 | GEO
Project description:Acute myeloid leukemia with normal karyotype (NK-AML) represents a cytogenetic grouping with intermediate prognosis but substantial molecular and clinical heterogeneity. Within this subgroup, presence of FLT3 (FMS-like tyrosine kinase 3) internal tandem duplication (ITD) mutation predicts less favorable outcome. The goal of our study was to discover gene-expression patterns correlated with FLT3-ITD mutation, and to evaluate the utility of a FLT3 signature for prognostication. The dataset comprises gene-expression profiles of 137 normal karyotype acute myeloid leukemia (NK-AML) specimens carried out using Stanford cDNA microarrays, to accompany the study of L Bullinger et al. For each array, Channel 2 represents Cy5-labeled NK-AML RNA, and Channel 1 Cy3-labeled universal reference RNA. Keywords: Logical Set DNA microarrays were used to profile gene expression in a training set of 65 NK-AML cases. Supervised analysis was applied to build a gene expression-based predictor of FLT3-ITD mutation status. The predictor was then evaluated by classifying expression profiles from an independent test set of 72 NK-AML cases.
2008-02-27 | E-GEOD-8043 | biostudies-arrayexpress
Project description:Acute myeloid leukemia with normal karyotype (NK-AML) represents a cytogenetic grouping with intermediate prognosis but substantial molecular and clinical heterogeneity. Within this subgroup, presence of FLT3 (FMS-like tyrosine kinase 3) internal tandem duplication (ITD) mutation predicts less favorable outcome. The goal of our study was to discover gene-expression patterns correlated with FLT3-ITD mutation, and to evaluate the utility of a FLT3 signature for prognostication. The dataset comprises gene-expression profiles of 137 normal karyotype acute myeloid leukemia (NK-AML) specimens carried out using Stanford cDNA microarrays, to accompany the study of L Bullinger et al. For each array, Channel 2 represents Cy5-labeled NK-AML RNA, and Channel 1 Cy3-labeled universal reference RNA. Keywords: Logical Set
2008-02-28 | GSE8043 | GEO
Project description:FLT3 activating mutations cause myeloproliferative neoplasms by deregulating hematopoietic progenitor cell growth, and acute myeloid leukemia is on the rise. Investigational drugs targeting mutant FLT3, including Quizartinib and Crenolanib, develop inherent and acquired resistance to FLT3 targeted therapy. FLT3 inhibitor resistance in AML is dependent on co-occurring mutations, parallel survival pathways, and/or subsequent FLT3-ITD mutations. Despite the high prevalence of FLT3 mutations and their clinical significance in AML, there are few targeted therapeutic options. We identified two novel naphthyridine-based FLT3 inhibitors (HSN608 and HSN748) that specifically target FLT3-ITD at sub-nanomolar concentrations and are effective against drug-resistant secondary mutations. In the current study, we evaluated these compounds antileukemic activity against FLT3-ITD and gatekeeper mutations in drug-resistant AML, relapsed/refractory AMLs with FLT3 mutations, and in vivo mouse models with combinations of epigenetic mutations TET2 with FLT3-ITD, and AML patients PDX. In these model systems, we demonstrate that HSN748 outperforms the FDA-approved FLT3 inhibitor Gilteritinib in terms of inhibitory activity against FLT3-ITD.
2022-12-07 | MSV000090855 | MassIVE
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy.
2014-01-15 | GSE54065 | GEO
Project description:Constitutively activating internal tandem duplication (ITD) alterations of the receptor tyrosine kinase FLT3 (Fms-like tyrosine kinase 3) are common in acute myeloid leukemia (AML) and classifies FLT3 as an attractive therapeutic target. So far, application of FLT3 small molecule inhibitors such as Sorafenib has resulted only in partial and transient clinical responses in FLT3-ITD+ patients. Only recently, a prolonged event-free survival has been observed in AML patients who were treated with Sorafenib in addition to standard therapy. Here, we studied the Sorafenib effect on proliferation in a panel of 13 FLT3-ITD- and FLT3-ITD+ AML cell lines. Sorafenib IC50 values ranged from 0.001 to 5.6 µM, whereas FLT3-ITD+ cells (MOLM-13, MV4;11) were found more sensitive to Sorafenib than FLT3-ITD- cells. However, we identified two FLT3-ITD- cell lines (MONO-MAC-1 and OCI-AML-2) which were also Sorafenib sensitive. Phosphoproteome analyses revealed that the affected pathways differed in Sorafenib sensitive FLT3-ITD- and FLT3-ITD+ cells. In MV4;11 cells Sorafenib suppressed mTOR signalling by inhibiting direct inhibition of FLT3. In MONO-MAC-1 cells Sorafenib inhibited the MEK/ERK pathway by inhibition of the RET tyrosine kinase. These data suggest that the FLT3 status in AML patients might not be the only predictive factor for a response to Sorafenib.
2017-05-02 | PXD004442 | Pride
Project description:Internal tandem duplications in the tyrosine kinase receptor FLT3 (FLT3-ITD) are among the most common lesions in acute myeloid leukemia (AML) and there exists a need for new forms of treatment. Using ex vivo drug sensitivity screening, we found that FLT3-ITD+ patient cells are particularly sensitive to HSP90 inhibitors. While it is well known that HSP90 is important for FLT3-ITD stability, we found that HSP90 family members play a much more complex role in FLT3-ITD signaling than previously appreciated. First, we found that FLT3-ITD activates the unfolded protein response (UPR), leading to increased expression of GRP94/HSP90B1. GRP94 rewires FLT3-ITD signaling by binding and retaining FLT3-ITD in the ER, where it aberrantly activates downstream signaling pathways. Second, HSP90 family proteins protect FLT3-ITD+ AML cells against apoptosis by alleviating proteotoxic stress, and treatment with HSP90 inhibitors results in proteotoxic overload that triggers UPR-induced apoptosis. Importantly, leukemic stem cells are strongly dependent upon HSP90 for their survival, and the HSP90 inhibitor ganetespib causes leukemic stem cell exhaustion in mouse PDX models. Taken together, our study reveals a molecular basis for HSP90 addiction of FLT3-ITD+ AML cells and provides a rationale for including HSP90 inhibitors in the treatment regime for FLT3-ITD+ AML.
2020-09-02 | PXD009423 | Pride
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress
Project description:The presence of FLT3-ITD mutations in patients with acute myeloid leukemia (AML) is associated with poor clinical outcome. FLT3 tyrosine kinase inhibitors (TKIs), although effective in kinase ablation, do not eliminate FLT3-ITD+ leukemia stem cells (LSCs) which are potential sources of disease relapse, prompting us to ask whether FLT3-ITD protein regulates the AML LSCs survival through a kinase-independent mechanism. Here, we show that expression of PRMT1, the primary type I arginine methyltransferase, significantly increases in LSC-enriched CD34+CD38- populations relative to normal counterparts. Genetic PRMT1 depletion blocked AML CD34+ cell survival, and had more potent effects in AML cells from patients harboring FLT3-ITD. Our genome wide analysis of gene expression and PRMT1 conditional KO mouse study confirmed that PRMT1 preferentially cooperates with FLT3-ITD contributing to AML cell maintenance. Mechanistically, PRMT1 catalyzed FLT3-ITD protein methylation at arginines 972/973, and PRMT1 promoted leukemia cell growth in a FLT3 methylation-dependent manner. Moreover, effects of FLT3-ITD methylation in AML cells were in part due to crosstalk with FLT3-ITD phosphorylation at tyrosine 969 (Y969). Importantly, FLT3 methylation persisted in FLT3-ITD+ AML cells following TKI (AC220) treatment, indicating that methylation occurs independently of kinase activity. Finally, in both patient-derived xenograft (PDX) and murine AML models, combined administration of AC220 with a type I PRMT inhibitor (MS023) enhanced elimination of FLT3-ITD+ AML relative to AC220 treatment alone. Our study demonstrates that PRMT1-mediated FLT3 methylation promotes LSC activity and suggests that combining PRMT1 inhibition with FLT3 TKI treatment could be a promising approach to selectively target FLT3-ITD+ LSCs.
2021-11-10 | GSE122435 | GEO
Project description:Acute myeloid leukemia (AML) is a heterogeneous disease and AML with normal karyotype (AML-NK) is categorized as an intermediate-risk group. Over the past years molecular analyses successfully identified biomarkers that will further allow to dissecting clinically meaningful subgroups in this disease. Thus far, somatic mutations were identified which elucidate the disturbance of cellular growth, proliferation, and differentiation processes in hematopoietic progenitor cells. In AML-NK, acquired gene mutations with prognostic relevance were identified for FLT3, CEBPA, and NPM1. FLT3-ITD mutations were associated with short relapse-free and overall survival, while mutations in CEBPA or NPM1 (without concomitant FLT3-ITD) had a more favorable outcome. Here, we present a multicenter study investigating gene expression profiles of 251 cases of de novo AML-NK. In three centers whole-genome microarray analyses were performed to delineate robust and common expression signatures for molecular markers in AML-NK. All samples were obtained from untreated patients at the time of diagnosis. Cells used for microarray analysis were collected from the purified fraction of mononuclear cells after Ficoll density centrifugation (Dresden, n=78; Munich, n=97; Ulm, n=77). Each laboratory performed its routine diagnostic algorithms, including the characterization of molecular markers.
2009-12-31 | E-GEOD-15434 | biostudies-arrayexpress