Browse
Submit Data
Databases
API
Help

Dataset Information

540 Views

0 Connections

1 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Analytical framework for peptidomics applied to large scale neuropeptide identification

ABSTRACT: Endogenous peptides are extracted and seperated with nLC with HCD fragmentation on a LTQ Orbitrap Velos. Data analysis was done with Mascot and MaxQuant

INSTRUMENT(S): LTQ Orbitrap Velos

ORGANISM(S): Rattus Rattus (black Rat)

TISSUE(S): Brain

SUBMITTER: Christian Kelstrup

LAB HEAD: Jesper V. Olsen

PROVIDER: PXD002431 | Pride | 2016-05-03

REPOSITORIES: Pride

ACCESS DATA

Json Xml

Publications

Analytic framework for peptidomics applied to large-scale neuropeptide identification.

Secher Anna A Kelstrup Christian D CD Conde-Frieboes Kilian W KW Pyke Charles C Raun Kirsten K Wulff Birgitte S BS Olsen Jesper V JV

Nature communications 20160504

Large-scale mass spectrometry-based peptidomics for drug discovery is relatively unexplored because of challenges in peptide degradation and identification following tissue extraction. Here we present a streamlined analytical pipeline for large-scale peptidomics. We developed an optimized sample preparation protocol to achieve fast, reproducible and effective extraction of endogenous peptides from sub-dissected organs such as the brain, while diminishing unspecific protease activity. Each peptid ...[more]

PMID: 27142507

Similar Datasets

Analytical framework for peptidomics applied to large scale neuropeptide identification

Project description:Endogenous peptides are extracted and seperated with nLC with HCD fragmentation on a LTQ Orbitrap Velos. Data analysis was done with Mascot and MaxQuant

2017-02-16 | MSV000080552 | MassIVE

Analytic framework for peptidomics applied to large-scale neuropeptide identification.

Project description: Not available

| S-EPMC4857386 | biostudies-literature

Peptidomics of Cpe(fat/fat) mouse brain regions: implications for neuropeptide processing.

Project description: Not available

| S-EPMC2663970 | biostudies-literature

bigSCale: An Analytical Framework for Big-Scale Single Cell Data

Project description:Single-cell RNA sequencing significantly deepened our insights into complex tissues and latest techniques are capable to analyze ten-thousands of cells simultaneously. With bigSCale, we provide an analytical framework being scalable to analyze millions of cells, addressing challenges of future large data sets. Unlike other methods, bigSCale does not constrain data to fit an a priori-defined distribution and instead uses an accurate numerical model of noise. We evaluate the performance of bigSCale using a biological model of aberrant gene expression and simulated data sets, which underlined its speed and accuracy. We further apply bigSCale to analyze 1.3 million cells from the mouse developing forebrain. The directed down-sampling strategy identified rare populations, such as Reelin positive Cajal-Retzius neurons, for which we determined a previously not recognized heterogeneity associated to distinct differentiation stages, spatial organization and cellular function. Together, bigSCale presents a perfect solution to address future challenges of large single-cell data sets.

2018-04-15 | GSE102934 | GEO

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

Project description:This SuperSeries is composed of the following subset Series: GSE14694: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) GSE14695: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards) Refer to individual Series

2009-06-02 | E-GEOD-14696 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to assess the reproducibility of small RNA datasets produced using Illumina sequencing-by-synthesis technology (SBS). We analyzed the reproducibility of small RNA SBS datasets by comparing libraries generated for biological replicates (rep1 and rep2) and technical replicates (rep2 and rep3).

2009-06-02 | E-GEOD-14694 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.

2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress

Gene expression in phagocytic and non-phagocytic Entamoeba histolytica populations

Project description:The ability of Entamoeba histolytica to phagocytose host cells correlates to observed virulence in vivo. To better understand the mechanism of phagocytosis we used paramagnetic beads coated with host ligand and sorted trophozoites based on phagocytic ability. Gene expression was then measured in both the sorted phagocytic and non-phagocytic populations using a custom Affymetrix chip for E. histolytica. Feed forward regulation of phagocytosis by Entamoeba histolytica. Infection and Immunity. PMID 23045476 M280 Streptavidin Dynabeads (Invitrogen) were labeled with 20ug/mL biotinylated Human C1q (Quidel). Entamoeba histolytica (strain HM1) were washed twice with PBS then resuspended with the labeled beads at a 10:1 ratio of beads to trophozoites. Samples were incubated at 37Â°C for 45 minutes, washed twice with agitation to remove adherent beads, then resuspended in MACS buffer. Samples were loaded into magnetic columns (Miltenyi Biotec) and trophozoites were seperated according to manufacturer's protocols. phagocytic vs. non-phagocytic Entamoeba histolytica populations

2012-10-16 | E-GEOD-41604 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

Project description:This SuperSeries is composed of the SubSeries listed below.

2009-06-03 | GSE14696 | GEO

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

2009-06-03 | GSE14695 | GEO