Dataset Information

NuRD and CAF-1-mediated silencing of the D4Z4 array is modulated by DUX4-induced MBD3L proteins

ABSTRACT: This study was designed to identify proteins associated with the D4Z4 macrosatellite repeat array in human muscle cells using a locus-specific proteomics approach (enChIP-MS).

INSTRUMENT(S): LTQ Orbitrap Elite

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Cell Culture

SUBMITTER: Yuko Ogata

LAB HEAD: Stephen J. Tapscott

PROVIDER: PXD006839 | Pride | 2018-03-02

REPOSITORIES: Pride

ACCESS DATA

Publications

NuRD and CAF-1-mediated silencing of the D4Z4 array is modulated by DUX4-induced MBD3L proteins.

Campbell Amy E AE Shadle Sean C SC Jagannathan Sujatha S Lim Jong-Won JW Resnick Rebecca R Tawil Rabi R van der Maarel Silvère M SM Tapscott Stephen J SJ

eLife 20180313

The DUX4 transcription factor is encoded by a retrogene embedded in each unit of the D4Z4 macrosatellite repeat. DUX4 is normally expressed in the cleavage-stage embryo, whereas chromatin repression prevents DUX4 expression in most somatic tissues. Failure of this repression causes facioscapulohumeral muscular dystrophy (FSHD) due to mis-expression of DUX4 in skeletal muscle. In this study, we used CRISPR/Cas9 engineered chromatin immunoprecipitation (enChIP) locus-specific proteomics to charact ...[more]

PMID: 29533181

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Project description:DUX4 is a double homeodomain transcription factor whose misexpression in the muscle causes facioscapulohumeral muscular dystrophy (FSHD). The transcriptional activity of DUX4 has been extensively characterized, and is thought to be the primary driver of FSHD pathogenesis. Yet, DUX4 expression lowers the protein level of an RNA quality control factor, UPF1, without affecting its transcript level, hinting at post-transcriptional regulatory activity downstream of DUX4 expression. How extensive the post-transcriptional activity of DUX4 is, and how relevant it is to FSHD pathogenesis, is unknown. In order to gain insight into DUX4-induced post-transcriptional gene regulation, we measured transcript and protein levels in DUX4 expressing cells via RNA-seq and SILAC-based quantitative mass spectrometry, respectively. We show that DUX4 transcriptional targets are robustly translated, including those genes previously identified as potential FSHD biomarkers. However, comparing the overall pattern of gene expression changes for RNA versus protein reveals striking differences in the most highly activated pathways, with the former showing changes in RNA processing and splicing, and the latter affecting the humoral immune response, proteolysis and exocytosis, among other pathways. Consistent with a misregulation of exocytosis, fluorescence imaging shows fragmented golgi apparatus in DUX4-expressing cells. Of the genes that showed discordant RNA and protein expression levels, post-transcriptional buffering was particularly evident for genes involved in stress response and may explain why DUX4-expressing cells succumb to toxicity despite robust transcriptional activation of stress response genes. Moreover, several genes involved in RNA decay including UPF1, UPF3B, SMG6 and XRN1 showed downregulation at the protein level, which may explain the massive inhibition of RNA quality control in DUX4-expressing cells. These results highlight the importance of considering post-transcriptional gene regulation in DUX4-expressing cells in order to fully understand the FSHD disease process.

Dataset Information

NuRD and CAF-1-mediated silencing of the D4Z4 array is modulated by DUX4-induced MBD3L proteins

Publications

NuRD and CAF-1-mediated silencing of the D4Z4 array is modulated by DUX4-induced MBD3L proteins.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure