Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Hippocampal circadian proteomes of young and middle-aged mice

ABSTRACT: Hippocampal tissues from young and middle-aged C57BL/6J mice were harvested at 4-hour intervals over two days and processed for proteomic analysis using label-free quantification.

INSTRUMENT(S): LTQ Orbitrap Elite

ORGANISM(S): Mus Musculus (mouse)

TISSUE(S): Brain

SUBMITTER: Paula Adler

LAB HEAD: Daniel Figeys

PROVIDER: PXD013364 | Pride | 2020-05-26

REPOSITORIES: Pride

ACCESS DATA

Json Xml

Publications

Aging Disrupts the Circadian Patterns of Protein Expression in the Murine Hippocampus.

Adler Paula P Chiang Cheng-Kang CK Mayne Janice J Ning Zhibin Z Zhang Xu X Xu Bo B Cheng Hai-Ying Mary HM Figeys Daniel D

Frontiers in aging neuroscience 20200115

Aging is associated with cognitive decline and dysregulation of the circadian system, which modulates hippocampal-dependent memory as well as biological processes underlying hippocampal function. While circadian dysfunction and memory impairment are common features of aging and several neurodegenerative brain disorders, how aging impacts the circadian expression patterns of proteins involved in processes that underlie hippocampal-dependent memory is not well understood. In this study, we profile ...[more]

PMID: 32009941

Similar Datasets

Quantitative proteomic analysis of hippocampal tissues from mice treated with a CK1δ/ε inhibitor

Project description:Hippocampal tissues from 3xTg-AD mice treated with a CK1δ/ε inhibitor or vehicle, and non-transgenic mice treated with vehicle, were harvested and processed for proteomic analysis using label-free quantification.

2019-07-30 | PXD012281 | Pride

Plasma from Rainbow trout housed for 7 days in normoxic and hypoxic water

Project description:Hypoxic water had 5 mg/L of Dissolved Oxygen (DO) and normoxic water had 11.5 mg/L DO. 40 immature rainbow trout (about 100 g) were housed for 7 days under these conditions (20 fish in each treatment). Then fish were anesthetized with 100 mg/L MS-222, and blood was sampled using caudal puncture with heparinized syringes. The blood was centrifuged at 10 000 x g for 4 minutes in Heraeus Fresco 21 centrifuge (Thermo Fisher). Plasma was removed from this using a pipette, and placed in cryotubes, flash frozen in liquid nitrogen, and then stored at -80oC until preparation for proteomic analysis.

2021-06-18 | PXD026589 | Pride

Lack of hepatic response of microRNA in mice following chronic benzo(a)pyrene exposure

Project description:This SuperSeries is composed of the following subset Series: GSE24907: Lack of hepatic response of microRNA in mice following chronic benzo(a)pyrene exposure (gene expression) GSE24909: Lack of hepatic response of microRNA in mice following chronic benzo(a)pyrene exposure (miRNA) Refer to individual Series

2011-10-18 | E-GEOD-24910 | biostudies-arrayexpress

Nasal septum deviation as the consequence of BMP-controlled changes to cartilage properties

Project description:Nasal septum deviation (NSD) is a common abnormality of the septal cartilage often associated with disordered breathing. The etiology of NSD is unknown. BMP7 neural crest-knockout mice, a well-characterized model for midfacial hypoplasia and nasal airway obstruction, develops a deviated septum by 4 weeks of age. Using comparative gene expression, quantitative proteomics, and immunofluorescence analysis we investigated the septum prior, immediately preceding, and with established deviation. We provide a detailed description of cellular and molecular changes leading to septum deviation, including changes to extracellular matrix organization, cell metabolism, and chondrocyte differentiation. Loss of BMP7 was associated with acquisition of elastic cartilage properties, a switch to glucose metabolism, and molecular characteristics commonly associated with osteoarthritis (OA). Many alterations preceded the deviation establishing that molecular changes to chondrocyte properties predispose to the deviation. Interestingly, NSD was associated with a persistent increase in BMP2. Genetic reduction of BMP2 in BMP7ncko mice restores WNT signalling, energy metabolism, and rescues NSD, showing the importance of balanced BMP signaling for normal cartilage. Many of the cellular and molecular changes have been described for knee osteoarthritis, suggesting that these two pathologies might have a similar underlying etiology.

2021-04-30 | PXD024813 | Pride

Expression data from Control or ShSuz12 rat Intestinal epithelial cells IEC-6

Project description:Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial cell (IEC) phenotype is not known. We investigated the impact of Suz 12 depletion on gene expression in IEC-6 cells. Multiple shRNA lentiviral constructs were tested in IEC-6 cells for their ability to down-regulate Suz12 expression (MISSION shRNA lentiviral transduction particles, SigmaM-bM-^@M-^SAldrich Canada, Oakville, ON). Forty percent confluent cells were infected in medium supplemented with 4 mg/ml polybrene (SigmaM-bM-^@M-^SAldrich Canada) for 6 h. Two days after infection, cell populations were selected with 2 mg/ml puromycin (SigmaM-bM-^@M-^SAldrich Canada). The clone TRCN0000038728 was selected: the shRNA against Suz12 (GCTGACAATCAAATGAATCAT) is conserved in rat (accession number FM084383), murine (accession number NM_199196) and human (accession number NM_015355.2) Suz12 sequences. Efficiency of infection was estimated at 25%. Control or ShSuz12 IEC-6 cell total RNAs were isolated with the Rneasy kit (Qiagen, Mississauga, ON, Canada), according to the manufacturerM-bM-^@M-^Ys instructions. RNA samples from three independent experiments were used for microarray analysis.

2014-08-02 | E-GEOD-60003 | biostudies-arrayexpress

Murine hippocampal proteome - Phosphoproteome Profiling Reveals Circadian Clock Regulation of Posttranslational Modifications in the Murine Hippocampus

Project description:The circadian clock is an endogenous oscillator that drives daily rhythms in physiology, behavior and gene expression. The underlying mechanisms of circadian timekeeping are cell-autonomous and involve interconnecting transcription-translation feedback loops. The hippocampus plays an important role in spatial memory and the conversion of short-term to long-term memory. Several studies have reported the presence of a peripheral oscillator in the hippocampus, and have highlighted the importance of circadian regulation in memory formation. In this study we performed global quantitative proteome and phosphoproteome analyses of the murine hippocampus across the circadian cycle, applying spiked-in labeled reference and high accuracy mass spectrometry.

2017-04-11 | PXD005668 | Pride

Lack of hepatic response of microRNA in mice following chronic benzo(a)pyrene exposure (miRNA)

Project description:Benzo[a]pyrene (BaP) is a very extensively studied prototypical polycyclic aromatic hydrocarbons (PAHs). Previous work in our laboratory showed no changes of microRNA (miRNA) expression in liver following a 3 days exposure to BaP, suggesting a lack of miRNA transcriptional responses to aryl hydrocarbon receptor agonists and/or DNA damage. Here, we studied 25-week old male MutaTM Mouse exposed to 25, 50, and 75 mg/kg/day BaP by oral gavage for 28 consecutive days. MAANOVA identified 110 differentially expressed genes (adjusted p < 0.05) with fold change greater than 1.5. The genes most affected included those involved in xenobiotic metabolism, phase II metabolizing enzymes, as well as the downstream targets of p53. Pathway specific RT-PCR was used to confirm the p53 response. A single significant increase in miRNA expression was identified (mir-34a and validated using the Qiagen miScript PCR system). This miRNA is known to be transcriptionally activated by p53. Ingestion of BaP leads to widespread changes in gene expression in mouse liver, with enrichment of genes involved in cell cycle arrest, DNA damage response, and apoptosis via the p53 pathway. In contrast, miRNA expression was relatively unaffected. Only miR-34a was significantly up-regulated, and may therefore play a critical role in the post-transcriptional regulation of p53 and/or its downstream targets. Keywords: Agilent mouse 8 x 15K miRNA microarray system with miRNA complete labeling and hyb kit were used to assess miRNA expression in response to 25, 50, and 75 mg/kg BaP treatment RNA samples from 3 control and 5 mice per treatment group (24mg/kg, 50mg/kg, and 75mg/kg) containing 100 ng were labelled using Agilent?s miRNA complete labelling and Hyb Kit (Agilent Tech, Mississauga, ON, Canada).

2011-10-18 | E-GEOD-24909 | biostudies-arrayexpress

Transcription profiling of human hormone treated MCF7 breast cancer cells in the presence or absence of cycloheximide

Project description:Estrogen receptors (ERs), which mediate the proliferative action of estrogens in breast cancer cells, are ligand-dependent transcription factors that regulate expression of their primary target genes through several mechanisms. In addition to direct binding to cognate DNA sequences, ERs can be recruited to DNA through other transcription factors (tethering), or affect gene transcription through modulation of signaling cascades by non-genomic mechanisms of action. To better characterize the mechanisms of gene regulation by estrogens, we have identified more than 700 putative primary and more than 1500 putative secondary target genes of estradiol in MCF7 cells through microarray analysis performed in the presence or absence of the translation inhibitor cycloheximide. Experiment Overall Design: RNA samples were collected 24 h after treatment of MCF7 cells with vehicle or 17{beta}-estradiol (25 nM). Cells were pre-treated 1 h before E2 stimulation with cycloheximide (CHX, 10 microg/ml). Microarray analysis was performed with four replicates for each condition.

2008-06-16 | E-GEOD-8597 | biostudies-arrayexpress

Metaproteomic responses of in vitro gut microbiomes to resistant starches

Project description:Resistant starches (RS) are dietary compounds processed by the gut microbiota into metabolites, such as butyrate, that are beneficial to the host. The production of butyrate by the microbiome appears to be affected by the plant source and type of RS as well as the individual’s microbiota. In this study, we used in vitro culture and metaproteomic methods to explore the consistency and variations in individual microbiome's functional responses to three types of RS - RS2(Hi Maize 260), RS3(Novelose 330) and RS4(Fibersym RW). Results showed that RS2 and RS3 significantly altered the levels of protein expression in the individual gut microbiomes, while RS4 did not result in significant protein changes. Significantly elevated protein groups were enriched in carbohydrate metabolism and transport functions of families Eubacteriaceae, Lachnospiraceae and Ruminococcaceae. In addition, Bifidobacteriaceae was significantly increased in response to RS3. We also observed taxon-specific enrichments of starch metabolism and pentose phosphate pathways corresponding to this family. Functions related to starch utilization, ABC transporters and pyruvate metabolism pathways were consistently increased in the individual microbiomes in response to RS2 and RS3; in contrast, the downstream butyrate producing pathway response varied. Our study confirm that different types of RS have markedly variable functional effects on the human gut microbiome, and also found considerable inter-individual differences in microbiome pathway responses.

2021-09-08 | PXD017907 | Pride

DNA packaging bias and differential expression of gene transfer agent genes within a population during production and release of the Rhodobacter capsulatus gene transfer agent, RcGTA

Project description:Rhodobacter capsulatus produces a gene transfer agent (GTA) called RcGTA. RcGTA is a phage-like particle that packages R. capsulatus DNA and transfers it to other R. capsulatus cells. Low-resolution techniques suggested RcGTA packages random DNA. Analysis of the RcGTA terminase sequence revealed a distant relationship to the phage T4 terminase protein, which can also perform sequence-independent packaging. We quantified the relative frequency of packaging for each gene in the genome by hybridization of DNA from RcGTA particles to an R. capsulatus microarray. All genes were found within the RcGTA particles, and random packaging was observed at a genome-wide scale. However, the genes encoding the RcGTA particle were under-packaged compared to other regions. Single-cell expression analysis demonstrated that RcGTA gene expression is not uniform within a culture. We propose a mechanism by which high levels of RcGTA gene transcription in the most active RcGTA producing cells hinders access of the packaging machinery to these genes, which causes a reduction in their packaging frequency. This sub-population gene expression phenomenon likely explains the lack of observed cell lysis in RcGTA producing cultures. DNA extracted from within RcGTA particles produced by DE442, an RcGTA overproducer, was hybridized to an Affymetrix genechip custom array in order to quantify the relative frequency with which any given gene was packaged within the particles. These data were MAS5 normalized. An underlying packaging bias was suspected to be transcription related, so these frequencies were compared to expression levels within the population, as determined by hybridization of late-stationary RNA samples of DE442 and of the wildtype (SB1003) to the same custom array. These data were RMA normalized.

2012-05-21 | E-GEOD-33176 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data