Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Aptamer Affinity Mass Spectrometry

ABSTRACT: Antibody-based affinity purification of macromolecular complexes has revolutionized the study of protein-protein interactions. Here, we present AptA-MS (Aptamer Affinity – Mass Spectrometry), a robust strategy using a specific, high-affinity RNA aptamer against GFP to identify novel interactors of a GFP-tagged protein using high resolution MS. AptA-MS offers a high signal-to-noise ratio due to the absence of immunoprecipitation-derived contaminants and allows the identification of post-translational modifications without the need for modification-specific enrichments.

INSTRUMENT(S): Q Exactive

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Diploid Cell

SUBMITTER: Angela Kruse

LAB HEAD: Michelle Cilia Heck

PROVIDER: PXD015620 | Pride | 2020-06-17

REPOSITORIES: Pride

ACCESS DATA

Json Xml

Publications

RNA aptamer capture of macromolecular complexes for mass spectrometry analysis.

Ray Judhajeet J Kruse Angela A Ozer Abdullah A Kajitani Takuya T Johnson Richard R MacCoss Michael M Heck Michelle M Lis John T JT

Nucleic acids research 20200901 15

Specific genomic functions are dictated by macromolecular complexes (MCs) containing multiple proteins. Affinity purification of these complexes, often using antibodies, followed by mass spectrometry (MS) has revolutionized our ability to identify the composition of MCs. However, conventional immunoprecipitations suffer from contaminating antibody/serum-derived peptides that limit the sensitivity of detection for low-abundant interacting partners using MS. Here, we present AptA-MS (aptamer affin ...[more]

PMID: 32609809

Similar Datasets

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.

2019-12-31 | GSE137006 | GEO

Gene expression atlas for mouse olfactory sensory neurons

Project description:Identification of all genes expressed by mouse olfactory sensory neurons; genes expressed in mature neurons, immature neurons, or both were distinguished. Independent validation of enrichment ratio values supported by statistical assessment of error rates was used to build a database of statistical probabilities of the expression of all mRNAs detected in mature neurons, immature neurons, both types of neurons (shared), and the residual population of all other cell types. FACS was used to separate a highly GFP+++ sample enriched in immature neurons, a weakly GFP+ sample slightly enriched in mature neurons, and a GFP- sample that contained all cell types in the olfactory epithelium but depleted of immature neurons.

2011-11-02 | E-GEOD-33368 | biostudies-arrayexpress

ACE-Scan of the ATP DNA aptamer on 10^12 density Gen1 DNA microarray

Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.

2017-12-20 | E-MTAB-6374 | biostudies-arrayexpress

ACE-Scan of the cocaine DNA aptamer on 10^12 Gen1 DNA microarray

2017-12-20 | E-MTAB-6377 | biostudies-arrayexpress

ACE-Scan of the ATP DNA aptamer on various density Gen2 DNA microarrays

2017-12-20 | E-MTAB-6375 | biostudies-arrayexpress

ACE-Scan of the ATP RNA aptamer on 10^12 Gen1 DNA microarray

2017-12-20 | E-MTAB-6376 | biostudies-arrayexpress

ACE-Scan of the thrombin DNA aptamer on 10^10 Gen1 DNA microarrays with sodium and potassium buffers in two colors.

2017-12-20 | E-MTAB-6378 | biostudies-arrayexpress

ACE-Scan of the natural add riboswitch aptamer on 10^10 Gen1 DNA microarrays with varying buffer temperatures and Mg2+ cation concentrations

2017-12-20 | E-MTAB-6380 | biostudies-arrayexpress

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

E. coli Affinity purification MS/MS

Project description:The tRNA linked repeat sequence rrB was tagged in either 5'- or 3'- end with the MS2 aptamer and expressed from a plasmid in E. coli. Using the MS2 aptamer, the RNAs were affinity purified after cell lysis. The co-purifying proteins were identified by NanoLC-MS/MS and compared to the proteins co-purifying with the MS2 sequence alone.

2021-04-26 | PXD013749 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data