Dataset Information

Proteomic characterization of primary and brain metastatic lung adenocarcinomas in a well-defined patient cohort

ABSTRACT: Lung adenocarcinoma (LADC) is the most common subtype of non-small cell lung cancer (NSCLC). One major feature of disease progression is the metastatic spread to the central nervous system (CNS). Treatment regimens for brain metastases are limited, thus distant metastases remain the leading cause of tumour-associated deaths globally. The central aim of this paper was to investigate the differences of LADC and brain metastases with reference to fast and slowly progressing patients. Additionally, we elucidated the differences between patients with single versus multiple brain metastases.

INSTRUMENT(S): Q Exactive HF

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Brain, Lung

DISEASE(S): Lung Adenocarcinoma

SUBMITTER: Nicole Woldmar

LAB HEAD: Gyorgy Marko-Varga

PROVIDER: PXD027259 | Pride | 2023-03-11

REPOSITORIES: Pride

ACCESS DATA

Publications

Proteomic analysis of brain metastatic lung adenocarcinoma reveals intertumoral heterogeneity and specific alterations associated with the timing of brain metastases.

Woldmar N N Schwendenwein A A Kuras M M Szeitz B B Boettiger K K Tisza A A László V V Reiniger L L Bagó A G AG Szállási Z Z Moldvay J J Szász A M AM Malm J J Horvatovich P P Pizzatti L L Domont G B GB Rényi-Vámos F F Hoetzenecker K K Hoda M A MA Marko-Varga G G Schelch K K Megyesfalvi Z Z Rezeli M M Döme B B

ESMO open 20221216 1

<h4>Background</h4>Brain metastases are associated with considerable negative effects on patients' outcome in lung adenocarcinoma (LADC). Here, we investigated the proteomic landscape of primary LADCs and their corresponding brain metastases.<h4>Materials and methods</h4>Proteomic profiling was conducted on 20 surgically resected primary and brain metastatic LADC samples via label-free shotgun proteomics. After sample processing, peptides were analyzed using an Ultimate 3000 pump coupled to a QE ...[more]

PMID: 36527824

Publication: 1/2

Similar Datasets

Project description:Background: Metastases to the brain from breast cancer have a high mortality. Basal-like and HER2 positive breast cancers appear to have a high propensity to spread to the brain. The mechanisms that allow cells to colonise the brain are unclear. Methods: We have analysed matched and unpaired samples of breast cancer and brain metastases using morphology, immunophenotype and expression profiling and validated the data using in vitro cell culturing models and in vivo mice model. Results: Most of the brain metastases were triple negative and had a basal-like phenotype. Metastatic cells to the brain over-expressed HER3 compared to primaries and showed evidence of higher activation of the MAPK pathways. Inhibition using anti-neuregulin antibody, Herceptin and Lapatinib reduced tumour growth in vitro and in vivo. Conclusions: The data demonstrate activation of neuregulin-HER3 pathway in brain metastases from breast cancer and suggest that even in absence of HER2 amplification (as with triple negative and basal cancers), anti-epidermal growth factor receptor family inhibitors may have a role in treating these patients An initial set of 29 matched pairs of primary breast cancer and their brain metastases and 22 unmatched brain metastases of from breast cancer was were available as formalin fixed-paraffin embedded (FFPE) tumor blocks. A second set of validation samples comprisinged of 10 matched pairs of primary breast cancer and their corresponding brain metastases and a further 11 non-breast metastatic brain cancers tumours fromn non-breast sites (one melanoma, six lung adenocarcinomas, one prostate carcinoma, one colon carcinoma and two renal cell carcinomas was also studied. After filtering DASL data on the first set of samples, 15/29 matched pairs and 22/22 unmatched metastases remained available for analysis for the initial set. In the second set all samples were analysed. RNA extraction and Real-Time RT-PCR Three 5Î¼m thick FFPE sections of clinical samples, parental cell line MB-MDA-231 cell line (fixed in paraformoldehyde and embedded in paraffin) and intracranial mouse tumours were cut and de-waxed in two lots of xylene and two lots of 100% ethanol, 10 minutes each. RNA was extracted using the High Pure RNA Paraffin KitÂ® (Roche Applied Science, Mannheim, Germany) according to the manufacturerâs protocol. RNA was quantified using the NanoDropÂ® ND-1000 (NanoDrop Technologies, DE, USA). RT-PCR for HER3 and housekeeping genes GAPDH and RPL13a was carried out using the Rotor-gene system (Corbett Life Science, Australia). Complementary DNA (cDNA) was synthesized from 240ng of total RNA using oligodT16 primers and the SuperScriptTM III Reverse Transcriptase kit (Invitrogen, Carsbald, CA, USA). A standard curve for gene expression of HER3 and GAPDH and RPL13a was constructed using total RNA from a human breast cancer cell line (SKBR-3). Replicates of 10-fold dilutions of RNA in water were made to give 3 different calibrators, each with a known amount of SKBR-3 RNA for which arbitrary copy number were given. The PCR conditions were: 50Â°C for 2 minutes, 95Â°C for 2 minutes, followed by 40 cycles with the following profile: denaturation at 95Â°C for 20 seconds, annealing at 60Â°C for 15 seconds, extension at 72Â°C for 20 seconds. Flourescent incorporation was acquired in the green channel during the 72Â°C incubations. Intron spanning primer sequences were: GAPDH (5âCTGCACCACCAACTGCTTAG3â, 5âGTCTTCTGGGTGGCA GTGAT3â), RPL13a (5âGTTGGTGTTCATCCGTTG3â, 5âGTACGCTGTGAAGCATCAA3â), HER3 (5âTGGTTCATGGGCATGTATCC3â, 5âCTAGACCTAAGACTTGGAGC3â). DASL gene expression profilingGene expression profiling was performed using the DASL assay (cDNA-mediated annealing, selection extension and ligation, Illumina Inc., California, USA) interrogating the DASL Cancer Panel that contained 512 cancer related genes. The first and second sets of samples were analyzed in two independent experiments. Tumours arising from the animal experiment were analyzed in conjunction with the second set of clinical samples. All protocols were as specified by Illumina Inc. Briefly, RNA (250ng) was converted to cDNA through a reverse transcription reaction with biotinylated oligo-d(T)18 and random nonamers. Oligonucleotides (three unique pairs for each of the 512 genes) were annealed to the biotinylated cDNA, the duplexes were bound to streptavidin conjugated paramagnetic particles to remove non-hybridized oligos. The annealed oligos were then extended and ligated (to incorporate an address sequence and primer site) to generate amplifiable products. These products were subjected to PCR amplification using fluorescently labeled (Cy3 and Cy5) primers. The labeled PCR products were hybridized to a Sentrix array or Beadchip. Following hybridization, the arrays were scanned with a BeadArray Reader (Illumina) and data was extracted using BeadStudio software (Illumina). Samples exhibiting a median hybridization intensity across all probes of <600 (background corrected) were excluded from analysis. Probes with a BeadStudio detection score greater than 0.99 in more than 15 conditions were included. Array data transformation and normalization (per chip normalized to 50th percentile and per gene normalized to median) was done in GenespringÂ® version 7.0 software (Agilent Technologies, Santa Clara, USA). Hierarchical clustering was performed using: Similarity measure; Pearson Correlation and clustering algorithm; Average Linkage. Genes differentially expressed between primary tumors and brain metastases were identified using analysis of variance (ANOVA, p<0.01) or parametric test, variances not assumed equal (Welch t-test, p < 0.005). Up and down regulation was considered for normalized data values that were greater or less than a factor of 2 fold for the conditions compared.

Project description:Sentinel lymph node, the first node draining the primary tumor, is a key component of tumor microenvironment promoting immune tolerance. In melanoma, sentinel node is one of the most important prognostic factors and the most frequent site of regional metastasis. To unravel the immunomodulatory pathways that are triggered by melanoma cells in the draining node that allow tumor spreading, transcriptional profiles associated to disease progression were analyzed in archival sentinel node biopsies (SNB). Gene expression profiles of melanoma-positive and negative SNB selected to maximize the differences in terms of disease stage and course, revealed subgroups correlating with regional node involvement and disease progression within positive biopsies. Transcriptional profiles revealed that genes showing differential expression between tumor-positive SNB with/without disease progression were mainly related to inflammatory response and that were mostly down regulated in patients with poor prognosis. TNFRSF8 encoding CD30 showing up regulation in SNB from patients with progressing disease displayed higher expression by immunohistochemical staining compared to SNB from non progressing patients. Subpopulations of CD30 positive CD4/CD8 double negative and CD4 Foxp3/PD-1 CD147 positive T cells were identified by flow cytometry analysis in metastatic nodes, suggesting a potential role of regulatory and tolerogenic T cells in melanoma progression. Cutaneous melanoma patients undergoing SNB biopsy in 2001-2004 with available 5M-bM-^@M-^Syear follow-up clinical data were selected. Data relative to 752 cases was extracted, 80% (n= 603) with a negative SNB and 20% (n=149) with SNB positivity for melanoma metastases. The latter underwent regional lymphadenectomy by CLND and 30% (n=44) resulted positive for melanoma metastases at non-sentinel regional lymph nodes while 70% (n=105) resulted negative. Analysis of follow-up data showed that disease recurrence at 5 yrs occurred in 9% SNB negative patients, 14% of the patients with positive SNB resulting negative at CLND, and in 57% of the patients with positive SNB resulting positive at CLND, consistent to the range of previously reported rates (Santinami M 2009, Balch CM 2009). In order to exploit gene expression profiles to unravel molecular modifications occurring in SNB from patients with progressing disease we selected two groups of cases representing the extremes of the survey, i.e. patients positive at CLND (stage IIIB-C) recurring within 5 years follow-up (SNB-PP), and patients negative at CLND (stage IIIA-B) and non-relapsing at 5 years (SNB-PN). In addition, a group of negative SNB patients without disease recurrence at 5 years was selected and analysed for comparison as tumor negative SNB (SNB-N).

Dataset Information

Proteomic characterization of primary and brain metastatic lung adenocarcinomas in a well-defined patient cohort

Publications

Proteomic analysis of brain metastatic lung adenocarcinoma reveals intertumoral heterogeneity and specific alterations associated with the timing of brain metastases.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure