Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

TMT proteomics and phosphoproteomics of SARS-CoV-2 infected Calu-3 cells

ABSTRACT: Proteomics and phosphoproteomics measurments of human a lung epithelial cell line (Calu-3 cells) infected with the novel coronavirus SARS-CoV-2 over a time-course of 4,8 and 12 hours.

INSTRUMENT(S): Orbitrap Exploris 480

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Lung Epithelial Cell

SUBMITTER: Tommaso Mari

LAB HEAD: Matthias Selbach

PROVIDER: PXD030395 | Pride | 2022-07-08

REPOSITORIES: Pride

ACCESS DATA

Json Xml

Publications

In Vitro Kinase-to-Phosphosite Database (iKiP-DB) Predicts Kinase Activity in Phosphoproteomic Datasets.

Mari Tommaso T Mösbauer Kirstin K Wyler Emanuel E Landthaler Markus M Drosten Christian C Selbach Matthias M

Journal of proteome research 20220524 6

Phosphoproteomics routinely quantifies changes in the levels of thousands of phosphorylation sites, but functional analysis of such data remains a major challenge. While databases like PhosphoSitePlus contain information about many phosphorylation sites, the vast majority of known sites is not assigned to any protein kinase. Assigning changes in the phosphoproteome to the activity of individual kinases therefore remains a key challenge. A recent large-scale study systematically identified in vit ...[more]

PMID: 35608653

Similar Datasets

Proteomics and phosphoproteomics of SARS-CoV-2 and IAV treated APCs

Project description:The clinical course of SARS-CoV-2 infection is highly variable with a subset of patients developing severe COVID-19 and acute respiratory distress syndrome (ARDS). COVID-19 induced lung injury and respiratory failure appears to be driven by dysregulated immune responses, yet the exact mechanisms remain unknown. Here, we analyzed monocytes isolated from healthy donors treated with SARS-CoV-2, influenza A (Panama strain) or TLR7/8 agonist R848. Notably, overnight exposure to SARS-CoV-2, but not influenza A virus, induced a profibrotic signature, characterized by high expression of known fibrogenic factors like TGFB1, SPP1 and LGMN, and showed highly significant similarity with profibrotic macrophage populations identified in idiopathic pulmonary fibrosis (IPF). In conclusion, SARS-CoV-2 triggers profibrotic macrophage responses, and ARDS-associated lung fibrosis.

2021-11-29 | PXD022709 | Pride

RNA-seq analysis of vorinostat-resistant HCT116 cells following gene knockdown of GLI1 or PSMD13 with or without vorinostat treatment

Project description:Transcriptome analysis was conducted on vorinostat resistant HCT116 cells (HCT116-VR) upon knockdown of potential vorinostat resistance candidate genes in the presence and absence of vorinostat. Potential vorinostat resistance candidate genes chosen for this study were GLI1 and PSMD13, which were identified through a genome-wide synthetic lethal RNA interference screen. To understand the transcriptional events underpinning the effect of GLI1 and PSMD13 knockdown (sensitisation to vorinostat-induced apoptosis), cells were first subjected to gene knockdown, then to treatment with vorinsotat or the solvent control. Two timepoints for drug treatment were assessed: a timepoint before induction of apoptosis (4hrs for siGLI1 and 8hrs for siPSMD13) and a timepoint when apoptosis could be detected (8hrs for siGLI1 and 12hrs for siPSMD13). There are 42 samples in total, from triplicate independent biological experiments of 14 samples each.

2016-06-30 | E-GEOD-57871 | biostudies-arrayexpress

Transcription profiling of reversibly switchable transgenic model of Myc-mediated cell tumorigenesis treated with tamoxifen sacrificed after 2, 4, 8, 24 h of treatment (activation cohort) or 2, 4, 6, days after a 21 day tamoxifen treatment regime ended (regression cohort)

Project description:Transgenic mice expressing both the MycER and BclXL transgenes under the regulation of an insulin promoter were systemically injected with 4-hydroxytamoxifen to acutely activate MycER. Mice were sacrificed at 2, 4, 8 or 24hrs after injection or at time 0 (untreated control mice). For analysis of the effects of sustained Myc activation mice received daily doses of tamoxifen for 21days. Tumor regression was analysed by isolation of islets 2, 4 or 6 days after cessation of a 21 day course of treatment. All conditions were repeated in triplicate and gene expression levels compared between treated and untreated and activation and regression samples.

2007-12-12 | E-GEOD-4356 | biostudies-arrayexpress

Omental adipose tissue metaboproteome: differential dysregulation by chronic binge alcohol and ovariectomy in simian immunodeficiency virus-infected female macaques

Project description:Effective antiretroviral therapy (ART) has significantly reduced mortality of people living with HIV (PLWH). Increased survival and aging of PLWH is associated with increased incidence of at-risk alcohol use and of metabolic comorbidities; and in women, menopause may be an additional factor contributing to metabolic dysregulation, particularly in adipose tissue. We examined the differential effects of chronic binge alcohol (CBA) administration and ovariectomy (OVX) on the omental adipose tissue (OmAT) proteome of simian immunodeficiency virus (SIV) infected macaques. Quantitative discovery-based proteomics identified 1429 differentially expressed proteins. Ingenuity Pathway Analysis calculated z-scores, or activation predictions for a disease or functional pathway. Results revealed functional pathways associated with protein changes centered around the “OmAT metaboproteome profile”. CBA did not affect functional pathways of metabolic disease; but dysregulated proteins involved in AMPK signaling and lipid metabolism. Based on IPA’s calculated z-score, OVX-mediated proteome changes promote pathways associated with glucose and lipid associated metabolic disease. Additionally, OVX was predicted to promote apoptosis, necrosis and reactive oxygen species (ROS) pathways, while CBA was predicted to inhibit these OVX-associated changes. These results provide evidence for the role of ovarian hormone loss in mediating OmAT metaboproteome dysregulation in HIV/SIV and suggest that CBA modifies OVX-associated changes. In the context of OVX, CBA administraton produced larger metabolic and cellular effects; which we speculate may reflect a protective role of estrogen against CBA-mediated adipose tissue injury in female SIV-infected macaques.

2022-08-12 | PXD023076 | Pride

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

RBM6 proximity interactions (RBM6-APEX)

Project description:We sought to map RBM6 interactome using ascorbate peroxidase (APEX2)-based proximity labelling combined with mass spectrometry. Toward this end, we used CRISPR-cas9 methodology to establish MCF10A cell line expressing APEX2 fused to the N-terminal of RBM6, hereafter called MCF10AAPEX2-RBM6. The peroxidase activity of APEX2-RBM6 fusion was confirmed. Next, RBM6 proximal proteins that were biotinylated by APEX2 activation using hydrogen peroxidase (H2O2) in the presence of biotin-phenol were isolated and subjected to mass spectrometry. We identified 173 (P-value<0.05) RBM6 proximity-interaction partners.

2021-12-29 | PXD024295 | Pride

Methylome analysis of 123 epiRILs, WT and ddm1 mutant aerial part

Project description:DNA methylation profiling in 123 epiRILs, WT and ddm1 mutant aerial part (epiRIL008 - epiRIL011 - epiRIL014 - epiRIL018 - epiRIL020 - epiRIL024 - epiRIL036 - epiRIL046 - epiRIL052 - epiRIL053 - epiRIL054 - epiRIL055 - epiRIL060 - epiRIL062 - epiRIL064 - epiRIL069 - epiRIL070 - epiRIL071 - epiRIL073 - epiRIL092 - epiRIL093 - epiRILv94 - epiRIL095 - epiRIL098 - epiRIL099 - epiRIL101 - epiRIL108 - epiRIL112 - epiRIL114 - epiRIL118 - epiRIL122 - epiRIL137 - epiRIL144 - epiRIL147 - epiRIL148 - epiRIL150 - epiRIL159 - epiRIL164 - epiRIL166 - epiRIL169 - epiRIL170 - epiRIL172 - epiRIL183 - epiRIL193 - epiRIL195 - - epiRIL202 - epiRIL208 - epiRIL215 - epiRIL216 - epiRIL218 - epiRIL222 - epiRIL225 - epiRIL229 - epiRIL232 - epiRIL238 - epiRIL244 - epiRIL252 - epiRIL257 - epiRIL258 - epiRIL260 - epiRIL262 - epiRIL275 - epiRIL276 - epiRIL277 - epiRIL297 - epiRIL305 - epiRIL315 - epiRIL323 - epiRIL326 - epiRIL333 - epiRIL340 - epiRIL344 - epiRIL350 - epiRIL356 - epiRIL362 - epiRIL361 - epiRIL363 - epiRIL366 - epiRIL368 - epiRIL371 - epiRIL375 - epiRIL391 - epiRIL393 - epiRIL394 - epiRIL400 - epiRIL408 - epiRIL410 - epiRIL425 - epiRIL432 - epiRIL434 - epiRIL437 - epiRIL438 - epiRIL439 - epiRIL454 - epiRIL458 - epiRIL466 - epiRIL467 - epiRIL471 - epiRIL473 - epiRIL477 - epiRIL480 - epiRIL488 - epiRIL492 - epiRIL493 - epiRIL494 - epiRIL495 - epiRIL497 - epiRIL500 - epiRIL503 - epiRIL506 - epiRIL508 - epiRIL523 - epiRIL538 - epiRIL539 - epiRIL556 - epiRIL558 - epiRIL559 - epiRIL561 - epiRIL567 - epiRIL570 - epiRIL572 - epiRIL573 - epiRIL579 - wt - ddm1 mutant) Keywords: Genome binding/occupancy profiling by genome tiling array 1 biological replicate in dye-swap - MeDIP-chip

2012-09-03 | E-GEOD-37284 | biostudies-arrayexpress

Methylome analysis of nerd1-1 mutant seedlings

Project description:DNA methylation profiling in nerd1-1 mutant seedlings 2 biological replicates in dye-swap - MeDIP-chip

2012-12-20 | E-GEOD-35344 | biostudies-arrayexpress

Divergent polypharmacology-driven cellular activity of structurally similar multi-kinase inhibitors through cumulative differential effects on individual targets: IMAC Phosphoproteomics

Project description:Despite recent successes of precision and immunotherapies there is a persisting need for novel targeted or multi-targeted approaches in complex diseases. Through a systems pharmacology approach including phenotypic screening, chemical and phosphoproteomics and RNA-Seq, we elucidated the targets and mechanisms underlying the differential anticancer activity of two structurally related multi-kinase inhibitors, foretinib and cabozantinib, in lung cancer cells. Biochemical and cellular target validation using probe molecules and RNA interference revealed a polypharmacology mechanism involving MEK1/2, FER and AURKB, which were each more potently inhibited by foretinib than cabozantinib. Based on this, we developed a synergistic combination of foretinib with barasertib, a more potent AURKB inhibitor, for MYC-amplified small cell lung cancer. This systems pharmacology approach showed that small structural changes of drugs can cumulatively, through multiple targets, result in pronounced anticancer activity differences and that detailed mechanistic understanding of polypharmacology can enable repurposing opportunities for cancers with unmet medical need.

2019-06-24 | PXD012963 | Pride

Impact of cellular miRNAs on the biomarker signatures of circulating miRNAs

Project description:This SuperSeries is composed of the following subset Series: GSE27230: Analysis of the impact of cellular miRNA signatures on the profiles of circulating miRNA biomarkers (fractionation data) GSE27253: Analysis of the impact of cellular miRNA signatures on the profiles of circulating miRNA biomarkers (variability data) Refer to individual Series

2011-06-17 | E-GEOD-27256 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data