NP-6A4 activates a novel signaling network of protective autophagy in obese female rat heart and attenuates cardiac dysfunction and coronary microvascular damage
Ontology highlight
ABSTRACT:
INSTRUMENT(S):
ORGANISM(S): Rattus Rattus (black Rat)
TISSUE(S): Heart
SUBMITTER: 
Brian Mooney
LAB HEAD: Lakshmi Pulakat
PROVIDER: PXD036596 | Pride | 2023-09-25
REPOSITORIES: Pride
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| 10_LP2_462_R4_389.d.zip | Other | |||
| 11_LP2_470_R5_390.d.zip | Other | |||
| 12_LP2_474_R6_391.d.zip | Other | |||
| 13_LP3_458_R1_393.d.zip | Other | |||
| 14_LP3_460_R2_394.d.zip | Other |
Items per page: 5 1 - 5 of 19 |
Publications
Cardiovascular Protective Effects of NP-6A4, a Drug with the FDA Designation for Pediatric Cardiomyopathy, in Female Rats with Obesity and Pre-Diabetes.
Belenchia Anthony M AM Boukhalfa Asma A DeMarco Vincent G VG Mehm Alexander A Mahmood Abuzar A Liu Pei P Tang Yinian Y Gavini Madhavi P MP Mooney Brian B Chen Howard H HH Pulakat Lakshmi L
Cells 20230512 10
<h4>Background</h4>Obese and pre-diabetic women have a higher risk for cardiovascular death than age-matched men with the same symptoms, and there are no effective treatments. We reported that obese and pre-diabetic female Zucker Diabetic Fatty (ZDF-F) rats recapitulate metabolic and cardiac pathology of young obese and pre-diabetic women and exhibit suppression of cardio-reparative AT2R. Here, we investigated whether NP-6A4, a new AT2R agonist with the FDA designation for pediatric cardiomyopat ...[more]
Similar Datasets
Project description:Human skeletal tissue contains an abundance of proteins some of which may be preserved over geological timescales. The profiling of proteins from ancient individuals — or palaeoproteomics —has begun to provide new information about the diseases suffered in past societies. We describe here the first dental palaeoproteomic profiles of Iron Age individuals, collected from the site of Long Long Rak rockshelter in northwest Thailand. We recovered amino acid sequences for thousands of proteins preserved in their dental tissue, however, it is evident that these palaeoproteomic profiles comprise a palimpsest of modifications that occurred both ante-mortem and post-mortem. Palaeoproteomic profiles are able to categorise disease and show the capacity of these individuals for harboring a variety of illnesses prior to death. Here we apply for the first time palaeoproteomic analysis to five prehistoric human teeth from Southeast Asia. We combine this method with stable isotope analysis using δ18O and δ13C values to broadly identify the diet of these individuals. The specimens were collected from log coffins contained within the Iron Age site of Long Long Rak (LLR) rockshelter in Pang Mapha district, Mae Hong Son Province, northwest Thailand.. Radiocarbon dating shows these log coffins to date within the range of 1,960±30 cal. yr BP to 1,636±44 cal. yr BP.
2019-11-20 | PXD008479 | Pride
Project description:In contrast to the desiccation tolerant (DT) ‘orthodox’ seeds, the so-called ‘intermediate’ seeds cannot survive complete drying and are short-lived. All species of the genus Coffea produce intermediate seeds but show a considerable variability for the seed DT level, which may help to decipher the molecular basis of seed DT in plants. We thus led a comparative transcriptome analysis of developing seeds in three coffee species with contrasting seed DT levels. Seeds of all species shared a major transcriptional switch during late maturation that governs a general slow-down of metabolism. However, numerous key stress-related genes, including those coding for the late embryogenesis abundant protein EM6 and the osmosensitive calcium channel ERD4, were upregulated during DT acquisition in the two species with high seed DT, C. arabica and C. eugenioides. By contrast, an upregulation of numerous players of the metabolism, transport and perception of auxin was observed in C. canephora seeds with low DT. Moreover, species with high DT showed a stronger down-regulation of the mitochondrial machinery dedicated to the tricarboxylic acid cycle and oxidative phosphorylation. Accordingly, respiration measurements during seed dehydration demonstrated that intermediate seeds with the highest DT levels are better prepared to cease respiration and avoid oxidative stresses.
2020-05-26 | PXD015806 | Pride
Project description:In this study, a unique tea cultivar ‘Anxi kucha’ was discovered for the first time, which is rich in both secondary metabolites. In the targeted data, theacrine (17.44 mg/g) was detected only in the ‘Anxi kucha’ tea plant in the test materials. The content of EGCG3"Me in ‘Anxi kucha’ (11.25mg/g), ‘Tieguanyin’ (5.32mg/g) and ‘Fudingdabaicha’ (0.93mg/g) showed high, medium and low changes. Through proteomics and transcriptomics, it was identified that the key pathways for the synthesis of theacrine and EGCG3"Me were the purine metabolism pathway and the flavonoid biosynthesis pathway, respectively. Combined proteome-transcriptome-metabolome analysis showed that SAMS3, APRT1, IMPDH, and TCS1 were the main enzymes promoting theacrine synthesis; CHI1, CHI2, FLS2 and LAR1 were the main enzymes that promote the synthesis of EGCG3"Me. The results of transcription factor analysis showed that MYB4 and bHLH74 had positive regulatory effects on the synthesis of theacrine and EGCG3"Me. Theacrine and EGCG3"Me are both bitter compounds. This study provides a valuable material rich in theacrine and EGCG3"Me, which provides a material basis for further development and utilization in the field of tea health food and a theoretical basis for studying the functional components of tea.
2025-05-26 | PXD062468 | Pride
Project description:H/D exchange analysis of the GEF SH3BP5 and its interaction with the GTPase Rab11
2018-09-18 | PXD010586 | Pride
Project description:Plant and virus materials, inoculation and symptom evaluation<br><br>Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). <br><br>The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA).<br><br><br><br>Microarray sample preparation and determination of viral titers<br><br>Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). <br><br>Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).<br><br>
2011-05-01 | E-MEXP-2389 | biostudies-arrayexpress
Project description:In this study, the hypolipidemic effects of Tamarindus indica fruit pulp extract (Tifpe) in the serum obtained from diet-induced hypercholesterolemic hamsters were investigated using two-dimensional gel electrophoresis and mass spectrometry. Significantly altered levels of serum proteins were validated using ELISA. Hamsters fed with Tifpe, both in the absence and presence of high-cholesterol diet, were shown to have significantly reduced levels of serum triglyceride, LDL-C and total cholesterol. The Tifpe fed non-hypercholesterolemic hamsters also showed significant enhanced levels of serum apolipoprotein A1 (APOA1), antithrombin III (ATIII), transferrin (TF), transthyretin and vitamin D binding protein (VDBP). In diet-induced hypercholesterolemic hamsters, APOA1, ATIII and TF, which were relatively low in levels, became significantly enhanced when the hamsters were fed with Tifpe. These Tifpe-fed hypercholesterolemic hamsters also showed significant higher levels of serum VDBP. Ingenuity Pathway Analysis of the Tifpe modulated serum proteins singled out “Lipid metabolism, molecular transport, small molecule biochemistry” as the top network. Our results suggest that the hypolipidemic effects of Tifpe are associated with alterations of serum proteins that are known to be cardioprotective and involved in the metabolism of lipids.
2018-10-04 | PXD010232 | Pride
Project description:SARS-CoV-2 emerged in China at the end of 2019 and caused the global pandemic of COVID-19, a disease with high morbidity and mortality. While our understanding of this new virus is rapidly increasing, gaps remain in our understanding of how SARS-CoV-2 can effectively suppress host cell antiviral responses. Recent work on other viruses has demonstrated a novel mechanism through which viral proteins can mimic critical regions of human histone proteins. Histone proteins are responsible for governing genome accessibility and their precise regulation is critical for a cell’s ability to control transcription and respond to viral threats. Here, we show that the protein encoded by ORF8 (Orf8) in SARS-CoV-2 functions as a histone mimic of the ARKS motif in histone 3. Orf8 is associated with chromatin, binds to numerous histone-associated proteins, and is itself acetylated within the histone mimic site. Orf8 expression in cells disrupts multiple critical histone post-translational modifications (PTMs) including H3K9ac, H3K9me3, and H3K27me3 and promotes chromatin compaction while Orf8 lacking the histone mimic motif does not. Further, SARS-CoV-2 infection in human cell lines and postmortem patient lung tissue cause these same disruptions to chromatin. However, deletion of the Orf8 gene from SARS-CoV-2 largely blocks its ability to disrupt host-cell chromatin indicating that Orf8 is responsible for these effects. Finally, deletion of the ORF8 gene affects the host-cell transcriptional response to SARS-CoV-2 infection in multiple cell types and decreases the replication of SARS-CoV-2 in human induced pluripotent stem cell-derived lung alveolar type 2 (iAT2) pulmonary cells. These findings demonstrate a novel function for the poorly understood ORF8-encoded protein and a mechanism through which SARS-CoV-2 disrupts host cell epigenetic regulation. Finally, this work provides a molecular basis for the finding that SARS-CoV-2 lacking ORF8 is associated with decreased severity of COVID-19.
2022-07-22 | PXD034379 | Pride
Project description:To identify dysregulated genes in HGF (Hereditary Gingival Fibromatosis) patients, expression profiling was performed using Affymetrix Human Genome U133 plus 2.0 arrays. Total RNA was extracted from gingival tissue specimens excised from two non-syndromic HGF patients, siblings in one family, and three normal controls. Quantity and integrity of the total RNA was measured and assessed by Nanodrop spectrophotometer (Thermo Fisher Scientific) and agarose gel electrophoresis. In brief, cDNA preparation, cRNA labeling, hybridization to Affymetrix Human Genome U133 plus 2.0 arrays, and chip scanning were performed in accordance with the manufacturer’s protocol (Affymetrix). *.CEL data from the raw chip scans were imported into the Partek GS 6.5 and normalized by RMA normalization algorithms. Comparisons between the HGF and control group were performed with one-way ANOVA (p≤0.05).
2019-12-31 | E-MTAB-7801 | biostudies-arrayexpress
Project description:Characterization of copy number alterations and unbalanced breakpoints in human esophageal squamous cell carcinoma cell lines by array-based comparative genomic hybridization. Six cell lines
2013-02-28 | E-GEOD-36115 | biostudies-arrayexpress
Project description:Canine heartworm is a widespread and potentially fatal mosquito-borne disease caused by infections with the parasitic nematode, Dirofilaria immitis. We have previously shown that systemic activation of the Toll immune pathway via silencing of the negative regulator Cactus in Aedes aegypti blocks parasite development in the Malpighian tubules, the mosquito renal organ. However, it was not established whether the Malpighian tubules were directly responding to Toll activation or were alternatively responding to upregulated proteins or other changes to the hemolymph driven by other tissues. Distinguishing these possibilities is crucial for developing more precise strategies to block D. immitis while potentially avoiding the fitness cost to the mosquito associated with Cactus silencing. This study defines the transcriptional response of Ae. aegypti Malpighian tubules after systemic Toll activation via intra-thoracic injection of dsCactus and found, like the response of whole mosquitoes, a significant increase in expression of Toll pathway target genes. Additionally, we identified a significant overlap between the transcriptional response of the Malpighian tubules and proteins upregulated in the hemolymph. Our data show that Malpighian tubules are capable of RNAi-mediated gene silencing and directly respond to dsCactus treatment by upregulating canonical Toll pathway targets. Though not definitive, the strong correspondence between the Malpighian tubule transcriptional and the hemolymph proteomic responses provides evidence that the tubules may contribute to mosquito humoral immunity.
2024-08-27 | PXD036225 | Pride