Cerebrospinal Fluid Proteomics of Aging Rats with Depression
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Q Exactive HF
ORGANISM(S): Rattus Norvegicus (rat)
TISSUE(S): Cerebrospinal Fluid
SUBMITTER: 
Li-Li Wu
LAB HEAD: Can Yan
PROVIDER: PXD038159 | Pride | 2023-03-11
REPOSITORIES: Pride
Publications
Exploration of the Core Pathways and Potential Targets of Luteolin Treatment on Late-Onset Depression Based on Cerebrospinal Fluid Proteomics.
Liu Kaige K Li Huizhen H Zeng Ningxi N Li Bozhi B Yao Gaolei G Wu Xiaofeng X Xu Hanfang H Yan Can C Wu Lili L
International journal of molecular sciences 20230209 4
Cognitive deficiency is one of the fundamental characteristics of late-onset depression (LOD). Luteolin (LUT) possesses antidepressant, anti-aging, and neuroprotective properties, which can dramatically enhance cognition. The altered composition of cerebrospinal fluid (CSF), which is involved in neuronal plasticity and neurogenesis, directly reflects the physio-pathological status of the central nervous system. It is not well known whether the effect of LUT on LOD is in association with a change ...[more]
Similar Datasets
Project description:Peripheral nerve injuries due to physical insults or chronic diseases are quite common, yet no pharmacological therapies are available for the effective repair of injured nerves. The slow growth rate of adult nerves and insufficient access to growth factors pose major hurdles in timely reinnervating target tissues and restoring functions after nerve injuries. A better understanding of the molecular changes that occur during the immediate regenerative reprogramming of neurons, stated here as in vivo priming, following nerve injury may reveal ideal candidates for future therapies. Hence, molecular profiling of neuronal soma within the first week of nerve injury has been the gold standard for revealing molecular candidates critical for nerve regeneration. A complementary in vitro regenerative priming approach was recently shown to induce enhanced outgrowth in adult sensory neurons. In this work, we exploited the in vitro priming model to reveal novel candidates for adult nerve regeneration. We performed the whole tissue proteomics analysis of in vitro primed DRGs and compared their molecular profile with that of the in vivo primed, and control DRGs. Through this approach, we identified several commonly and uniquely altered molecules in the in vitro and in vivo primed DRGs that have the potential to modulate adult nerve regrowth. We further validated the growth inducing potential of mesencephalic astrocyte-derived neurotrophic factor (MANF), one of the hits identified in our proteomics analysis, in primary adult sensory neurons. Overall, this study showed that in vitro priming partially reproduces the molecular features in in vivo primed adult sensory neurons. The shortlisted candidates presented here from the two priming approaches may serve as potential therapeutic targets for adult nerve regeneration.
2023-01-06 | PXD031927 | Pride
Project description:The post-translationally acylated Repeats in ToXins (RTX) leukotoxins, such as the adenylate cyclase (CyaA) or α-hemolysin (HlyA), bind β2-integrins of leukocytes, but also penetrate cells lacking these receptors. We show that the indole of conserved tryptophans within the acylated segments, e.g. W876 in CyaA and W579 in HlyA, is crucial for β2-integrin-independent membrane penetration of toxins. Substitutions of W876 by aliphatic or aromatic residues did not affect acylation, folding or activities of CyaA W876L/F/Y toxin variants on CR3-expressing cells. In contrast, toxin activity of CyaA W876L/F/Y on cells lacking CR3 was strongly impaired. Similarly, a W579L substitution selectively reduced HlyA W579L cytotoxicity towards cells lacking β2-integrins. Intriguingly, the W876L/F/Y substitutions increased the thermal stability (Tm) of CyaA by 4 to 8 °C. In addition, the hydrogen-deuterium exchange revealed structural changes in the acylated segment of the CyaA W876F variant, compared to intact CyaA. The substitution of W876 with a polar glutamine (W876Q), not increasing the Tm, or combining of the W876F substitution with a cavity-filling V822M substitution, decreasing the Tm of CyaA W876F+V822M to a value closer to that of CyaA, yielded a milder defect of toxin activity on erythrocytes lacking CR3. Furthermore, the activity of CyaA was selectively impaired on erythrocytes when the interaction of the pyrrolidine of P848 with the indole of W876 was ablated. These results suggest that the bulky indole of the W876 of CyaA, or W579 of HlyA, rules the local structural flexibility of the acylated segment. This may facilitate adoption of a membrane-penetrating conformation of the toxins in the absence of β2-integrin-mediated positioning of the toxin towards the cell membrane.
2023-07-11 | PXD041207 | Pride
Project description:Cortical 1.4C18 and medullary 3.10 TEC lines (mTEC) were cultured in 10% fetal bovine serum-supplemented RPMI 1640 medium at 37 ?C in a 5% CO2 atmosphere. Confluent cultures of 3.10 mTEC cell line were cultured during 72 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kitM-. (Ambion, Austin, TX, USA).
2011-08-31 | E-MEXP-3214 | biostudies-arrayexpress
Project description:Inflammation plays a central role in many human diseases. Human parturition also resembles an inflammatory reaction, where progesterone (P4) and progesterone receptors (PRs) have already been demonstrated to suppress contraction-associated gene expression. In our previous studies, we have found that the progesterone actions, including progesterone-induced gene expression and progesterone’s anti-inflammatory effect, are mediated by PR, GR or both. In this study, we used microarrays to find P4 and IL-1β responsive genes and which IL-1β responsive genes were repressed by P4. These data may provide a broader view of gene networks and cellular functions regulated by P4 and IL-1βin human myometrial cells. In our future study, this will also help us understand the role of PR and GR in human parturition. Primary cultures of human myometrial cells were grown from myometrial biopsies obtained at the time of elective caesarean section. Cells were exposed to different stimuli, IL-1β (5ng/mL) and P4 (10 µM), either alone or in combination for 6 h, and then total RNA were extracted from each culture. Three comparisons were carried out including: 1. V vs. P4; 2. V vs. IL-1β; 3. IL-1β vs. IL-1β+P4.
2015-08-13 | E-GEOD-68171 | biostudies-arrayexpress
Project description:The long term objective is to create an encyclopedia of the expression levels of all genes in multiple components of the developing kidney. The central thesis is straightforward. The combination of fluorescent activated cell sorting (FACS) plus microarray analysis offers a powerful, efficient and effective method for the creation of a global gene expression atlas of the developing kidney. Microarrays with essentially complete genome coverage can be used to quantitate expression levels of every gene in FACS isolated components of the developing kidney. The ensuing rapid read-out provides an expression atlas that is more sensitive, more economical and more complete than would be possible by in situ hybridizations alone. Tie2 transgenic mice were utilized to isolate the endothelial cells from the adult kidneys. Endothelial cells were isolated from the kidney using collagenase treatment and FACS. RNA was isolated and the gene expression profiles were determined by microarrays.
2010-01-25 | E-GEOD-20004 | biostudies-arrayexpress
Project description:Investigation whether hypoxic stabilization of HIF-1alpha quantitatively or qualitatively modifies the gene expression pattern induced by poly I:C, a TLR ligand that does not induce normoxic HIF-1alpha stabilization on its own (non-HIF-1alpha-stabilizing TLR ligand). Keywords: Comparison of single and combined treatment Bone marrow derived Dendritic Cells from mice were stimulated under normoxic or hypoxic conditions for 16h with media or poly I:C. Total cellular RNA was harvested, labeled and hybridised to Affymetrix Mouse Gene ST 1.0 GeneChips. Cel files were normalized with RMA.
2011-06-28 | E-GEOD-24995 | biostudies-arrayexpress
Project description:We used the TriFectaTM (IDT, Integrated DNA Technologies, Coralville, IA, USA) anti-Aire RNAi sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) in order to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10nM of anti-Aire siRNA using Hiperfect reagent (Qiagen, GmbH, Hilden, Germany) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kitM-. (Ambion, Austin, TX, USA), which served as template for cDNA synthesis.<br><br>Gene knockdown was confirmed by quantitative reverse transcription PCR (qRT-PCR) using the primers 5_-GCAACTCTGGCCTCAAAGAG-3_ forward and 5_-GGTCTGAATTCCGTTTCCAA-3_ reverse, which allowed amplification<br><br>of a 120 bp PCR product corresponding to a segment of the Aire cDNA. The cDNA samples were prepared using Superscript II<br><br>reverse transcriptase (Invitrogen Corporation, Carlsbad, CA, USA) enzyme, as recommended. Expression of the above mentioned genes was quantified using a 7500 Real Time PCR System (Applied Biosystems)
2011-08-31 | E-MEXP-3213 | biostudies-arrayexpress
Project description:We used the TriFectaTM (IDT, Integrated DNA Technologies,<br><br>Coralville, IA, USA) anti-Dicer RNAi sequence (AGAACGAAAUGCAAGGAAUGGACTCGAGUCCAUUCCUUGCAUUUCGUUCUUC, ACAAGAAACGGAAUCACAUCACACTAGUGUGAUGUGAUUCCGUUUCUUGUCG, GCAGUUGUCCUAAACAGAUUGAUAAUUAUCAAUCUGUUUAGGACAACUGCUG) to silencing Dicer mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 20 nM of each anti-Dicer siRNA using Hiperfect reagent (Qiagen) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by quantitative PCR (qRT-PCR) using the primers 5M-^RCCCAAATGTAGAACCCGAGA 3M-^R forward and 5M-^RCAACCGACACTGTCCATCG 3M-^R reverse, which allowed amplification of a 119 bp PCR product corresponding to a segment of the Dicer mRNA (cDNA). Transcriptional expression levels were determined using a StepOne Real-Time PCR System (Applied Biosystems, USA).
2011-08-30 | E-MEXP-3211 | biostudies-arrayexpress
Project description:Background: The heteroplasmic mitochondrial DNA (mtDNA) mutation A3243G causes the MELAS syndrome as one of the most frequent mitochondrial diseases. The process of reconfiguration of nuclear gene expression profile to accommodate cellular processes to the functional status of mitochondria might be a key to MELAS disease manifestation and could contribute to its diverse phenotypic presentation. Objective: To determine master regulatory protein networks and disease-modifying genes in MELAS syndrome. Methods: Analyses of whole blood transcriptomes from 10 MELAS patients using a novel strategy by combining classic Affymetrix oligonucleotide microarray profiling with regulatory and protein interaction network analyses. Results and Interpretation: Hierarchical cluster analysis elucidated that the relative abundance of mutant mtDNA molecules is decisive for the nuclear gene expression response. Further analyses confirmed not only transcription factors already known to be involved in mitochondrial diseases (such as TFAM), but also detected the hypoxia-inducible factor 1α (HIF-1α)/HIF-1β complex, nuclear factor Y (NF-Y) and CREB-related transcription factors as novel master regulators for reconfiguration of nuclear gene expression in response to the MELAS mutation. Correlation analyses of gene alterations and clinico-genetic data detected significant correlations between A3243G-induced nuclear gene expression changes and mutant mtDNA load as well as disease characteristics. These potential disease-modifying genes influencing the expression of the MELAS phenotype are mainly related to clusters primarily unrelated to cellular energy metabolism, but important for nucleic acid and protein metabolism, and signal transduction. Our data thus provide a framework to search for new pathogenetic concepts and potential therapeutic approaches to treat the MELAS syndrome. Peripheral blood samples were collected from ten A3243G MELAS patients and twenty age- and sex-matched healthy controls (2 controls for each patient). The patient cohort consisted of 4 females and 6 males, mean±s.e.m. age was 44.1±11.9 years (range: 22–63 years), mean±s.e.m. age at disease onset was 27.1±4.9 years (range: 13–55 years), mean±s.e.m. disease duration was 19.0±4.7 years (range: 4–43 years), and disease severity measured by the ‘Newcastle Mitochondrial Disease Adult Scale’ (NMDAS) 8 ranging from 0.0 (no symptoms) to 1.0 (maximum score) was 0.26±0.05 (range: 0.02–0.54).
2011-01-24 | E-GEOD-14882 | biostudies-arrayexpress
Project description:We investigated transcriptional changes in lymph node resident lymphatic endothelial cells and medullary sinus macrophages upon interactions with melanoma cell-derived extracellular vesicles using single-cell RNA sequencing.
2022-03-10 | E-MTAB-10434 | biostudies-arrayexpress