Dataset Information

Identification of N-terminal SUMOylation of mouse cofilin-1 by IP-MS

ABSTRACT: Small ubiquitin-like modifier (SUMO) typically conjugates to target proteins through isopeptide linkage to the ε-amino group of lysine residues. This posttranslational modification (PTM) plays pivotal roles in modulating protein function. As a key regulator of actin cytoskeleton dynamics, cofilins (CFLs) are well-known to undergo several different kinds of PTMs. Using mass spectrometry, our study identified the N-terminal α-amino group, rather than any of the ε-amino groups of the internal lysines, as the sole SUMO-conjugation site of cofilin-1 (CFL1).

INSTRUMENT(S): Q Exactive HF

ORGANISM(S): Mus Musculus (mouse)

SUBMITTER: Weiji Weng

LAB HEAD: Yong Li

PROVIDER: PXD038392 | Pride | 2023-10-24

REPOSITORIES: Pride

ACCESS DATA

Publications

N-terminal α-amino SUMOylation of cofilin-1 is critical for its regulation of actin depolymerization.

Weng Weiji W Gu Xiaokun X Yang Yang Y Zhang Qiao Q Deng Qi Q Zhou Jie J Cheng Jinke J Zhu Michael X MX Feng Junfeng J Huang Ou O Li Yong Y

Nature communications 20230914 1

Small ubiquitin-like modifier (SUMO) typically conjugates to target proteins through isopeptide linkage to the ε-amino group of lysine residues. This posttranslational modification (PTM) plays pivotal roles in modulating protein function. Cofilins are key regulators of actin cytoskeleton dynamics and are well-known to undergo several different PTMs. Here, we show that cofilin-1 is conjugated by SUMO1 both in vitro and in vivo. Using mass spectrometry and biochemical and genetic approaches, we id ...[more]

PMID: 37709794

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

Identification of N-terminal SUMOylation of mouse cofilin-1 by IP-MS

Publications

N-terminal α-amino SUMOylation of cofilin-1 is critical for its regulation of actin depolymerization.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure