Dataset Information

Mass spectrometry-based proteomic landscape of rice reveals a post-transcriptional regulatory role of N6-methyladenosine

ABSTRACT: Rice is one of the most important staple food and model species in plant biology, yet the quantitative proteomes of rice are largely uncharacterized. Here we quantify the relative protein levels of over 15,000 genes across rice major tissues using a tandem mass tag strategy followed by intensive fractionation and mass spectrometry. We identify tissue-specific or tissue-enriched proteins related to functional specificity of individual tissues. Proteogenomic comparison between rice and Arabidopsis reveals conserved proteome expression, which is different from mammals that strong separation of species rather than tissues. Notably, profiling of N6-methyladenosine (m6A) across the rice major tissues shows that m6A at untranslated regions is negatively correlated with protein abundance and contributes to the discordance of RNA and protein levels. We also demonstrate that our data are valuable to identify novel genes required for regulating m6A methylation. Taken together, this study provides a paradigm for in-depth proteogenomic studies of rice.

INSTRUMENT(S): Q Exactive HF

ORGANISM(S): Oryza Sativa (rice)

SUBMITTER: Zhe Liang

LAB HEAD: Liang zhe

PROVIDER: PXD041188 | Pride | 2024-05-01

REPOSITORIES: Pride

ACCESS DATA

Dataset's files

Source:

			Action	DRS
	ST_REP1_FRACTION10_202201288.raw	Raw
	ST_REP1_FRACTION11_202201288.raw	Raw
	ST_REP1_FRACTION12_202201288.raw	Raw
	ST_REP1_FRACTION13_202201288.raw	Raw
	ST_REP1_FRACTION14_202201288.raw	Raw

Items per page:

1 - 5 of 75

Publications

Mass spectrometry-based proteomic landscape of rice reveals a post-transcriptional regulatory role of N<sup>6</sup>-methyladenosine.

Li Shang-Tong ST Ke Yunzhuo Y Zhu Yunke Y Zhu Tian-Yi TY Huang Huanwei H Li Linxia L Hou Zhiyang Z Zhang Xuemin X Li Yaping Y Liu Chaofan C Li Xiulan X Xie Mengjia M Zhou Lianqi L Meng Chen C Wang Faming F Gu Xiaofeng X Yang Bing B Yu Hao H Liang Zhe Z

Nature plants 20240712 8

Rice is one of the most important staple food and model species in plant biology, yet its quantitative proteomes are largely uncharacterized. Here we quantify the relative protein levels of over 15,000 genes across major rice tissues using a tandem mass tag strategy followed by intensive fractionation and mass spectrometry. We identify tissue-specific and tissue-enriched proteins that are linked to the functional specificity of individual tissues. Proteogenomic comparison of rice and Arabidopsis ...[more]

PMID: 38997433

Similar Datasets

Project description:Endogenous small RNAs, including microRNAs (miRNAs) and short-interfering RNAs (siRNAs), function as posttranscriptional or transcriptional regulators in plants. miRNA function is essential for normal development and therefore likely to be important in the growth of the rice grain. To investigate the likely roles of miRNAs in rice grain development we carried out deep sequencing of the small RNA populations of rice grains. A total of 96,091 (including 23,867 reads from vegetative tissues) and 5,379,724 small RNA sequences that are longer than 17nt were generated. Approximately 94% of these small RNAs were 20-24nt in length. The majority of the small RNAs were singletons, indicating that rice genome has a very complex small RNA population, which is harder to be saturated. From these smal RNA sequences we found representatives of all 20 conserved plant miRNA families and evidence for changes in expression of miRNAs during rice grain development. Using an approach based on the presence of the miRNA and miRNA* sequences, we identified 51 novel, non-conserved rice miRNA families expressed in grains with functionally diverse predicted target genes. miRNA-guided cleavage was confirmed for a number of targets genes including ones with roles in sugar signalling and restoration of cytoplasmic male sterility. We identified a likely mirtron, indicating that plants can also use spliced introns as a source of miRNAs. Our sequencing results revealed four TAS3 loci; these all contain dual miR390 sites of which only the 3? site is cleaved. We also found a miRNA-like long hairpin generating phased 21nt small RNAs, strongly expressed in developing grains and show that these small RNAs act in trans to cleave target mRNAs. Keywords: high throughput pyrosequencing, small RNA, microRNA, grain development, rice Small RNA populations of shoots and roots of 7 days old seedlings, and 1-5 and 6-10 days after fertilization grains were determined using high throughput sequencing technology. The abundance of known miRNAs were compared based on the number of sequence reads. To give a whole picture of the rice small RNA populations and to reflect un-biasly the sequencing results, small RNAs that are longer than 17nt no matter whether or not they matched with the rice genome were included in this submitted dataset. The unmatched sequences may be derived from un-sequenced regions or sequencing errors.

Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').