Dataset Information

FTO inhibition attenuates obstruction-induced kidney fibrosis by downregulating ferroptosis activator ACSL4 and profibrotic factor TGFBI

ABSTRACT: Analysis by LC-MS/MS shotgun proteomics was performed on lysates from the following samples: 1) Control HK2 cells generated using control CRISPR/CAS9 system and scrambled guide RNA (sgRNAGCACTCACATCGCTACATCA) 2) HK2 cells with FTO knockout using CRISPR/Cas9 system and target 2 guide RNA (sgCCTACAAGTACCTGAACACC) 3) HK2 cells with FTO knockout using CRISPR/Cas9 system and target 3 guide RNA (sgCCAGGCTCTTTACGGTCCCC) 4) HK2 cells treated with vehicle control 5) HK2 cells treated with erastin 6) HK2 cells treated with FTO inhibitor FB23-2

INSTRUMENT(S):

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Epithelial Cell Of Proximal Tubule

SUBMITTER: Sharon Pitteri

LAB HEAD: Sharon Pitteri

PROVIDER: PXD051362 | Pride | 2025-10-13

REPOSITORIES: Pride

ACCESS DATA

Dataset's files

Source:

			Action	DRS
	Dalin-10_Shotgun_01.raw	Raw
	Dalin-10_Shotgun_01.raw_20221204_Byonic_database.xlsx	Xlsx
	Dalin-10_Shotgun_02.raw	Raw
	Dalin-10_Shotgun_02.raw_20221204_Byonic_database.xlsx	Xlsx
	Dalin-10_Shotgun_03.raw	Raw

Items per page:

1 - 5 of 111

Publications

FTO inhibition attenuates renal fibrosis by downregulating ferroptosis activator ACSL4 and profibrotic factor TGFBI.

Zhang Dalin D Chiu Chun-Lung CL Wen Ru R Qiu Zhengyuan Z Garcia-Marques Fernando F Bermudez Abel A Zhao Man M Zhao Hongjuan H Dixon Scott J SJ Peehl Donna M DM Rankin Erinn B EB Pitteri Sharon S Brooks James D JD

iScience 20250907 10

Renal fibrosis (RF) is the main pathological feature and a potential therapeutic target of chronic kidney disease (CKD), a prevalent health problem causing a high economic burden to the health care system. Fat mass and obesity-associated (FTO) inhibition, either genetically or pharmacologically, significantly reduced collagen deposition, lipid peroxidation, and ferroptosis marker expression after unilateral ureteral obstruction (UUO) compared with sham-operated controls in mice. In murine and hu ...[more]

PMID: 41050936

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome