Dataset Information

Identifying the phosphorylation sites on PNET1 protein in Arabidopsis.

ABSTRACT: The nuclear pore complex (NPC) is a cornerstone of eukaryotic cell functionality, orchestrating the essential transport of molecules between the nucleus and cytoplasm. Emerging evidence suggests its potential involvement in cell cycle regulation, but the specific roles and mechanisms of nucleoporins in this process remain largely uncharted. We previously found that PNET1 is a transmembrane nucleoporin and is expressed in actively dividing regions in Arabidopsis thaliana. Previous studies revealed that nucleoporins are phosphorylated during mitosis to facilitate the nuclear envelope breakdown process. In addition, we found that PNET1 extracted from callus tissues created a shifted band after running on Phos-tag gel, while this band was not observed when PNET1 is extracted from seedlings. We used LC-MS/MS to search the phosphorylation sites on PNET1 to further understand where exactly phosphorylation is happening and to create phospho-mimic and phospho-deficient versions of PNET1 later on. We detected more than 10 phosphorylation sites on PNET1.

INSTRUMENT(S):

ORGANISM(S): Arabidopsis Thaliana (mouse-ear Cress)

TISSUE(S): Callus

SUBMITTER: Shouling Xu

LAB HEAD: SHOULING XU

PROVIDER: PXD054530 | Pride | 2025-08-04

REPOSITORIES: Pride

ACCESS DATA

Dataset's files

Source:

			Action	DRS
	E20231027_02.pep.xml	Pepxml
	E20231027_02.raw	Raw
	E20231027_02_FTMSms2hcd.txt	Txt
	yiling_phosphopep_keeprep_v2.xlsx	Xlsx

Items per page:

1 - 4 of 4

Publications

Nucleoporin PNET1 coordinates mitotic nuclear pore complex dynamics for rapid cell division.

Fang Yiling Y Tang Yu Y Xie Peiqiao P Hsieh Kendall K Nam Heejae H Jia Min M Reyes Andres V AV Liu Yuchen Y Xu Shouling S Xu Xiaosa X Gu Yangnan Y

Nature plants 20250131 2

The nuclear pore complex (NPC) is a cornerstone of eukaryotic cell functionality, orchestrating the nucleocytoplasmic shuttling of macromolecules. Here we report that Plant Nuclear Envelope Transmembrane 1 (PNET1), a transmembrane nucleoporin, is an adaptable NPC component that is mainly expressed in actively dividing cells. PNET1's selective incorporation into the NPC is required for rapid cell growth in highly proliferative meristem and callus tissues in Arabidopsis. We demonstrate that the ce ...[more]

PMID: 39890949

Similar Datasets

Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.