Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Proteomic Profiling of Extracellular Vesicles Derived From Different State Of Polarized Microglia

ABSTRACT: Upon lipopolysaccharide (LPS) or interleukin-4 stimulation to trigger M1 or M2 polarized states respectively, label-free quantitative mass spectrometry (LFQ-MS) revealed novel state-specific proteomic profiles of microglia-derived exosomes.

INSTRUMENT(S):

ORGANISM(S): Mus Musculus (mouse)

TISSUE(S): Cell Culture

SUBMITTER: Yinan Zhou

LAB HEAD: Zhuge Qichuan

PROVIDER: PXD056226 | Pride | 2024-10-30

REPOSITORIES: Pride

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	IL4-1_Slot2-45_1_4486.d.zip	Other
	IL4-2_Slot2-45_1_4487.d.zip	Other
	IL4-3_Slot2-45_1_4488.d.zip	Other
	LPS-1_Slot2-44_1_4482.d.zip	Other
	LPS-2_Slot2-44_1_4483.d.zip	Other

Items per page:

1 - 5 of 10

Similar Datasets

Naringenin Suppresses BEAS-2B-derived Exosomal Cargoes Disorder Caused by Cigarette Smoke Extract thereby Inhibiting M1 Macrophage Polarization

Project description:Effects of cigaratte smoke extract and naringenin on the exosomal proteome derived from human airway epithelial cells

2022-07-13 | PXD033545 | Pride

Microarray of non-polarized and M1- and M2-polarized canine macrophages in vitro

Project description:Unstimulated (M0), M1-polarized (GM-CSF, LPS, IFNÎ³-stimulated), and M2-polarized (M-CSF, IL-4-stimulated) canine blood-derived macrophages were generated in vitro and investigated for differences in their transcriptome to create a basis for future investigations upon the role of macrophage polarization in dogs, a species, which has emerging importance for translational research.

2017-08-10 | E-MTAB-5458 | biostudies-arrayexpress

Effects of Lin28a overexpression on gene expression changes during culturing neural stem cells (NSCs) derived from mouse embryonic ventral midbrain (VM)

Project description:Purpose: we want to see gene expression changes during in vitro expansion of VM-derived NSCs (VM-NSCs) with cell passges in the absence or presence of Lin28a overexpression. changes upon Lin28 overexpression in P1 and P3 stages of Neural stem cells. RNA-seq, sRNA-seq, and Polysome-seq with/without Lin28 overexpression in P1 and P3 stages of Neural stem cells.

2016-08-11 | E-GEOD-77851 | biostudies-arrayexpress

Ubiquitination profile of polarized macrophages

Project description:Previous studies linked mac activation with the ubiquitination (ub) status of key proteins in inflammatory signal pathways. Lysine-48 ub (K48-ub) of the NF-κB inhibitor (IκB), the final checkpoint of the NFκB pathway, leads to IκB degradation and consequent NF-κB-associated inflammation. In contrast, TRAF6, an upstream positive regulator of the NF-κB pathway, is modulated by K63-ub, leading to its conformational change and activation. However, a comprehensive analysis of ub profiles of polarized macs has not been reported. If a unique ub signature is associated with individual mac subsets is not known.

2020-08-06 | PXD018743 | Pride

Ubiquitylation of RIPK3 beyond-the-RHIM limits RIPK3 activity and cell death

Project description:Pathogen recognition receptors and TNF superfamily members engage Receptor Interacting Serine/threonine Kinase-3 (RIPK3) to activate programmed cell death, including MLKL-mediated necroptosis and caspase-8-dependent apoptosis. However, the post-translational control of RIPK3 signalling is not fully understood. Using mass-spectrometry, we identified a novel ubiquitylation site on murine RIPK3 beyond the RIP homotypic interaction motif (RHIM) on K469. Complementation of RIPK3-deficient cells with a Ripk3K469R mutant demonstrated that the decoration of RIPK3 K469 by ubiquitin limits both RIPK3-mediated caspase-8 activation and apoptotic killing, in addition to RIPK3 autophosphorylation and MLKL-mediated necroptosis. Unexpectedly, the overall ubiquitylation of mutant RIPK3K469R was enhanced, which largely resulted from additional RIPK3 ubiquitylation on K359. Loss of RIPK3 K359 ubiquitylation reduced RIPK3K469R hyper-ubiquitylation and limited the ability of Ripk3K469R/K469R to trigger enhanced killing. Ripk3K469R/K469R mice challenged with Salmonella displayed increased bacterial loads in the spleen and liver, with reduced IFN serum levels. Therefore, RIPK3 K469 ubiquitylation can function to prevent RIPK3 ubiquitylation on alternate lysine residues, which otherwise promote RIPK3 oligomerization and consequent cell death signalling.

2022-08-12 | PXD026533 | Pride

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress

Identification of maize ZmCRY1c interacting proteins

Project description:GFP-ZmCRY1c IP-MS to identify ZmCRY1c interacting proteins enhanced by blue light

2025-11-22 | PXD071057 | Pride

Mycobacterium avium subsp. paratuberculosis infected cows reveal divergent immune response in bovine peripheral blood derived lymphocyte proteome

Project description:Bovine paratuberculosis is a serious chronic disease of the gastrointestinal tract caused by Mycobacterium avium subspecies paratuberculosis (MAP). The aim of this study was to detect proteomic changes in peripheral blood mononuclear cells (PBMC) from cows of the same herd with different MAP infection status after co-incubation with viable MAP in vitro using label-free LC-MS/MS. Our data contribute to a better understanding of the bovine immune response and mechanisms of susceptibility to MAP.

2023-03-10 | PXD036881 | Pride

Trancriptome-wide association of Not1and Polysomal occupancy in wt and not5 background

Project description:The following data contains sequencing files for RNA IP and Polysome profiling experiments in wt and not5delta strains with background of Not1-TAP tagged strain (MAT_ leu2_20 ura3_ met15_ lys2_ his3delta1 not1::NOT1-Tap-tag-URA3). The RNA IP experiments have been performed as described previously (Gupta et al 2014) and the Polysome profiling experiments have been performed as described in (Albanese 2010). The libraries have been sequenced using polyadenylation isoform specific profiling protocol. The Not1 RIP experiments demonstrate genome-wide association of RNA with the central essential scaffold of the Ccr4-Not complex. The same RIP experiment in the not5delta background demonstrates the specificity of not5 in determining Not1 binding specificity to pulled down RNA. The polysome profiling experiments demonstrate the role of not5 in determining the translatability of ribosomal RNA.

2015-12-19 | E-MTAB-3195 | biostudies-arrayexpress

A co-culture system of macrophages with breast cancer tumoroids to study cell interactions and therapeutic responses

Project description:3D tumoroids have revolutionized in vitro/ex vivo cancer biology by recapitulating the complex diversity of tumors. While tumoroid provide new insights into cancer development and treatment response, several limitations remain. The tumor microenvironment, especially the immune system, strongly influences tumor development. Absence of immune cells in tumoroids may yield flawed conclusions. Macrophages, key players in tumor progression, pose integration challenges into tumoroid. In this study, we established three optimized and standardized methods for co-culturing human macrophages with breast cancer tumoroids: a semi-liquid model and two matrix-embedded models tailored for specific applications. Optimizing culture conditions, we tracked interactions and macrophage infiltration using flow cytometry and light sheet microscopy. Macrophages not only influenced tumoroid molecular profiles but also chemotherapy response. This underscores the importance of increasing the complexity of current 3D models to more accurately reflect in vivo conditions. The three models have different application and can be used in various ways.

2024-05-31 | PXD052016 | Pride