Dataset Information

Data-driven rescoring meets identification transfer in multi-batch isobaric labeling experiments: the best of both worlds (ProSIMSIt)

ABSTRACT: Multi-batch isobaric labeling experiments are frequently applied for clinical and pharmaceutical studies of large sample cohorts. To tackle the critical issue of missing values in such studies, we introduce the ProSIMSIt pipeline. It combines the advantages of tandem mass spectrum clustering via SIMSI-Transfer and data-driven rescoring via Prosit and Oktoberfest. We demonstrate that these two tools are complementary and mutually beneficial. On large-scale cancer cohort data, ProSIMSIt increased the number of peptide spectrum matches (PSMs) by 40% on both global and phosphoproteome datasets. Furthermore, on data from proteome-wide drug-response profiling of post-translational modifications (decryptM), our pipeline substantially increased drug-PTM relations and unveils previously unseen downstream effects of drug target inhibition. ProSIMSIt is available as an open-source Python package with a simple command line interface that allows easy application to MaxQuant result files.

INSTRUMENT(S):

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Lung, Uterine Endometrium

SUBMITTER: Firas Hamood

LAB HEAD: Bernhard Kuster

PROVIDER: PXD057211 | Pride | 2025-05-07

REPOSITORIES: Pride

ACCESS DATA

Dataset's files

Source:

			Action	DRS
	10350_C05_P102888_B00_U01_R1_TMT11.raw	Raw
	10350_C05_P102888_B00_U01_R2_TMT11.raw	Raw
	10350_C06_P102889_B00_U01_R1_TMT11.raw	Raw
	10350_C06_P102889_B00_U01_R2_TMT11.raw	Raw
	10350_C07_P102890_B00_U01_R1_TMT11.raw	Raw

Items per page:

1 - 5 of 69

Publications

ProSIMSIt: The Best of Both Worlds in Data-Driven Rescoring and Identification Transfer.

Hamood Firas F Gabriel Wassim W Pfeiffer Pia P Kuster Bernhard B Wilhelm Mathias M The Matthew M

Journal of proteome research 20250322 4

Multibatch isobaric labeling experiments are frequently applied for clinical and pharmaceutical studies of large sample cohorts. To tackle the critical issue of missing values in such studies, we introduce the ProSIMSIt pipeline. It combines the advantages of tandem mass spectrum clustering via SIMSI-Transfer and data-driven rescoring via Prosit and Oktoberfest. We demonstrate that these two tools are complementary and mutually beneficial. On large-scale cancer cohort data, ProSIMSIt increased t ...[more]

PMID: 40119808

Publication: 1/3

Similar Datasets

Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.