Dataset Information

A distal activin-responsive super-enhancer regulates Fshb transcription and gonadotrope differentiation

ABSTRACT: A large “gene desert” located far upstream from Fshb and Kcna4 contains several gonadotrope-specific accessible chromatin sites which, in chromatin conformation capture (3C), were seen to make distinct contacts with both genes. The region displays several features of a super-enhancer and both genes were strongly suppressed by JQ-1, which represses super-enhancer activity. The sites of open chromatin were seen, in chromatin immunoprecipitation (ChIP), to bind Brd4 and Med1, most notably at a site located -67 kb from the Fshb gene, as well as binding Ctcf further upstream (at -123 kbp), all of which were increased following activin exposure. The locus is also transcribed to chromatin-associated lncRNAs whose levels correlate with Fshb and Kcna4 mRNA levels in vivo and in cultured gonadotrope cells, indicating coordinated regulation. CRISPR interference (CRISPRi) confirmed distinct functions for each of the elements on these genes and, together with the 3C data, indicate that the -67 kb locus mediates specifically both basal and activin-stimulated Fshb expression, while the site at -59 kb contributes to activin-stimulation of both genes. Single-cell multiomics showed that the -67 kb element is accessible in pituitary stem cells and during gonadotrope differentiation, preceding opening of the Fshb promoter, although it is closed in other differentiated cell types. Foxl2 was found to bind this element and contributes to maintaining its chromatin accessibility, seemingly by recruiting Supt16H, a component of the FACT complex, with which it interacts. These findings define a distal, activin-responsive super-enhancer that regulates Fshb transcription and shapes the gonadotrope regulatory landscape.

INSTRUMENT(S):

ORGANISM(S): Mus Musculus (mouse)

SUBMITTER: Dganit Melamed Kadosh

LAB HEAD: Philippa Melamed

PROVIDER: PXD072033 | Pride | 2026-04-27

REPOSITORIES: Pride

ACCESS DATA

Dataset's files

Source:

Items per page:

1 - 5 of 14

Publications

Accessibility at a primed distal Fshb-Kcna4 super-enhancer is facilitated by Foxl2 during gonadotrope differentiation.

Refael Tal T Golan Gil G Darsa Daniella D Pnueli Lilach L Chakravarty Probir P Rizzoti Karine K Melamed Philippa P

Endocrinology 20260401 5

A large "gene desert" located far upstream from Fshb and Kcna4 contains several gonadotrope-specific accessible chromatin sites that were seen in chromatin conformation capture to make distinct contacts with both genes. Expression of Fshb and Kcna4 was strongly inhibited by JQ-1, which represses super-enhancer activity, and the region displays super-enhancer characteristics. The sites of open chromatin were seen, in chromatin immunoprecipitation, to bind Brd4 and Med1, most notably at a site -67 ...[more]

PMID: 41823422

Similar Datasets

Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.

			Action	DRS
	94590txt.zip	Other
	Seq94590_HFX_b.raw	Raw
	Seq94591_HFX_b.raw	Raw
	Seq94592_HFX_b.raw	Raw
	Seq94593_HFX_b.raw	Raw