Identification of P-body components by proximity labeling and IP-MSMS
Ontology highlight
ABSTRACT:
INSTRUMENT(S):
ORGANISM(S): Pseudomonas Syringae Pv. Tomato Nicotiana Benthamiana Arabidopsis Thaliana (mouse-ear Cress)
TISSUE(S): Leaf
SUBMITTER: 
Mirita Franz-Wachtel
LAB HEAD: Suayb Üstün
PROVIDER: PXD074949 | Pride | 2026-03-17
REPOSITORIES: Pride
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| 20211222_CO_1066SuUe_R01.raw | Raw | |||
| 20211222_CO_1066SuUe_R02.raw | Raw | |||
| 20211222_CO_1066SuUe_R03.raw | Raw | |||
| 20211222_CO_1066SuUe_R04.raw | Raw | |||
| 20211222_CO_1066SuUe_R05.raw | Raw |
Items per page: 5 1 - 5 of 58 |
Similar Datasets
Project description:We applied single-end strand-specific RNA-seq experiments to compare the abundance of natural antisense transcripts in Arabidopsis. Examination of 3 wild type (WT) organs, including leaves, inflorescences and siliques.
2013-12-23 | E-GEOD-49950 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the following subset Series: GSE35315: Interaction between BZR1 and PIF4 integrates brassinosteroid and environmental responses [ChIP-seq] GSE37159: Interaction between BZR1 and PIF4 integrates brassinosteroid and environmental responses [RNA-seq] Refer to individual Series
2012-07-07 | E-GEOD-37160 | biostudies-arrayexpress
Project description:Plant growth is coordinately regulated by environmental and hormonal signals. Brassinosteroid (BR) plays essential roles in growth regulation by light and temperature, but the interactions between BR and these environmental signals remain poorly understood at the molecular level. Here, we show that direct interaction between the dark- and heat-activated transcription factor phytochrome-interacting factor4 (PIF4) and the BR-activated transcription factor BZR1 integrates the hormonal and environmental signals. BZR1 and PIF4 interact with each other in vitro and in vivo, bind to nearly two thousand common target genes, and synergistically regulate many of these target genes, including the PRE family HLH factors required for promoting cell elongation. Genetic analysis indicates that BZR1 and PIFs are interdependent in promoting cell elongation in response to BR, darkness, or heat. These results show that the BZR1-PIF4 interaction controls a core transcription network, allowing plant growth co-regulation by the steroid and environmental signals. RNA-Seq for Col-0, bzr1-1D, pifq and pifq;bzr1-1D seedlings grown on BRZ-containing medium in the dark.
2012-07-07 | E-GEOD-37159 | biostudies-arrayexpress
Project description:DNA methylation is an epigenetic mark that silences transposable elements (TEs) and repeats. Whereas the establishment and maintenance of DNA methylation are relatively well understood, little is known on their dynamics and biological relevance in plant and animal innate immunity. Here, we show that some TEs are demethylated and transcriptionally reactivated during antibacterial defense in Arabidopsis. This effect is concomitant with the down-regulation of key transcriptional gene silencing factors as well as an active demethylation process. DNA demethylation restricts multiplication and vascular propagation of the bacterial pathogen Pseudomonas syringae in leaves and, accordingly, some immune-response genes, containing repeats in their promoters, are negatively regulated by DNA methylation. This study provides evidence that DNA demethylation is part of a plant-induced immune response, potentially acting to prime transcriptional activation of some defense genes linked to Tes/repeats. We have monitored the transcript changes in Arabidopsis plants treated with a flagellin-derived peptide. DNA methylation is closely related to 24nt sRNAs. This is why we sequenced small RNA population in our study. 5-week-old Col-0 leaf samples (treated with either water or flg22 at 1 ?M concentration for 6 h) and deep sequenced by Fasteris (Geneva) on the Illumina HiSeq 2000 platform.
2013-02-04 | E-GEOD-40044 | biostudies-arrayexpress
Project description:To fully characterize smRNAs associated with AGO1 and AGO4, we developed a two-step protocol to purify AGO/smRNA complexes from flowers, leaves, roots and seedlings with enhanced purity, and sequenced the smRNAs by IlluminaM-CM-"M-BM-^@M-BM-^Ys technology. We identified some additional miRNAs, collateral miRNAs encoded in known miRNA precursors, phased smRNA clusters and nat-siRNAs. Organ specific sequencing provided digital expression profiles of all obtained smRNAs, especially miRNAs. We used extracts from Arabidopsis flowers, leaves and roots as well as ten-day old seedlings to purify smRNAs associated with AGO1 and AGO4 protein complexes using a two-step immunoprecipitation method.
2011-04-19 | E-GEOD-28591 | biostudies-arrayexpress
Project description:Plant nucleotide-binding leucine-rich repeat (NB-LRR) disease resistance (R) proteins recognize specific “avirulent” pathogen effectors and activate immune responses. NB-LRR proteins structurally and functionally resemble mammalian Nod-like receptors (NLRs). How NB-LRR and NLR proteins activate defense is poorly understood. The divergently transcribed Arabidopsis R genes, RPS4 (resistance to Pseudomonas syringae 4) and RRS1 (resistance to Ralstonia solanacearum 1), function together to confer recognition of Pseudomonas AvrRps4 and Ralstonia PopP2. RRS1 is the only known recessive NB-LRR R gene and encodes a WRKY DNA binding domain, prompting suggestions that it acts downstream of RPS4 for transcriptional activation of defense genes. We define here the early RRS1-dependent transcriptional changes upon delivery of PopP2 via Pseudomonas type III secretion. The Arabidopsis slh1 (sensitive to low humidity 1) mutant encodes an RRS1 allele (RRS1SLH1) with a single amino acid (leucine) insertion in the WRKY DNA-binding domain. Its poor growth due to constitutive defense activation is rescued at higher temperature. Transcription profiling data indicate that RRS1SLH1-mediated defense activation overlaps substantially with AvrRps4- and PopP2-regulated responses. To better understand the genetic basis of RPS4/RRS1-dependent immunity, we performed a genetic screen to identify suppressor of slh1 immunity (sushi) mutants. We show that many sushi mutants carry mutations in RPS4, suggesting that RPS4 acts downstream or in a complex with RRS1. Interestingly, several mutations were identified in a domain C-terminal to the RPS4 LRR domain. Using an Agrobacterium-mediated transient assay system, we demonstrate that the P-loop motif of RPS4 but not of RRS1SLH1 is required for RRS1SLH1 function. We also recapitulate the dominant suppression of RRS1SLH1 defense activation by wild type RRS1 and show this suppression requires an intact RRS1 P-loop. These analyses of RRS1SLH1 shed new light on mechanisms by which NB-LRR protein pairs activate defense signaling, or are held inactive in the absence of a pathogen effector. Five weeks old Arabidopsis (Ws-2 and rrs1-1) leaves were infiltrated with Pf0-1 carrying PopP2 or PopP2C321A in pEDV6 and samples were collected at 2, 4, 6 and 8 hours post infiltration (hpi); mRNA profiles were generated in triplet, by deep sequencing on Illumina GAIIx using EXPRSS tag-seq protocol.
2014-11-21 | E-GEOD-48247 | biostudies-arrayexpress
Project description:Deciphering the mechanism of secondary cell wall/SCW formation in vascular plants is key to understanding their development and the molecular basis of biomass recalcitrance. Although a sophisticated network of transcription factors has been implicated in SCW synthesis in plants, little is known about the implication of RNA-binding proteins in this process. Here we report that two RNA-binding proteins homologous to the animal translational regulator Musashi, Musashi-Like2/MSIL2 and Musashi-Like4/MSIL4, function redundantly to control SCW formation in interfascicular fibers and the setting of biomass recalcitrance. We show that the disruption of MSIL2/4 (msil2-4 mutant) decreases the abundance of lignin in fibers and triggers an hypermethylation of glucuronoxylan that is linked to an over-accumulation of GlucuronoXylan Methyltransferase1/3 (GXM1/3) proteins.
2023-09-28 | PXD040020 | Pride
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress
Project description:The apoplast is a critical interface in plant-pathogen interactions particularly in the context of pattern-triggered immunity (PTI), which is initiated by recognition of microbe-associated molecular patterns (PAMPs). Our study characterizes the proteomic profile of the Arabidopsis apoplast during PTI induced by flg22, a 22 amino acid bacterial flagellin epitope, to elucidate the output of PTI. Apoplastic washing fluid (AWF) was extracted with minimal cytoplasmic contamination for LC-MS/MS analysis. We observed consistent identification of PTI enriched and depleted peptides across replicates with limited correlation between total protein abundance and transcript abundance. We observed topological bias in peptide recovery of receptor-like kinases with peptides predominantly recovered from their ectodomains. Notably, tetraspanin 8, an exosome marker, was enriched in PTI samples. We additionally confirmed increased concentrations of exosomes during PTI. This study enhances our understanding of the proteomic changes in the apoplast during plant immune responses and lays the groundwork for future investigations into the molecular mechanisms of plant defense under recognition of pathogen patterns.
2025-02-11 | PXD060654 | Pride
Project description:Characterization of the activities of the transcription factors that AP3 and PI encode throughout flower development using perturbation and ChIPSeq assays in combination with a floral induction system (FIS) that allows a stage-specific analysis of flower development. Examination of genomic regions bound by fully functional AP3-GFP and PI-GFP proteins at approx floral stage 4-5 as compared to a negative control sample
2012-06-01 | E-GEOD-38358 | biostudies-arrayexpress