Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Homo sapiens

ABSTRACT: 16S rRNA amplicon sequencing of colorectal polyps

PROVIDER: PRJDB17852 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	DRR542882_1.fastq.gz	Fastqsanger.gz
	DRR542882_2.fastq.gz	Fastqsanger.gz
	DRR542883_1.fastq.gz	Fastqsanger.gz
	DRR542883_2.fastq.gz	Fastqsanger.gz
	DRR542884_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 258

Similar Datasets

Homo sapiens whole blood.

Project description:RNA extracted at 240min. Samples are rRNA depleted. Expression measurement of Homo sapiens genes.

2019-07-31 | GSE114179 | GEO

Small RNA sequencing of the 8 to 30-nucleotide window in homo sapiens

Project description:RNA-sequencing (RNA-Seq) protocols and bioinformatic pipelines are designed to streamline downstream analyses on sequences believed to be the most important. Here, we have challenged this dogma by preserving ribosomal RNA (rRNA) in our samples and by lowering the minimal RNA size window of our small RNA-Seq analyses to 8 nt

2022-09-01 | GSE179678 | GEO

Soil Metaproteomics LC-MS

Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.

2022-03-01 | PXD009773 | Pride

Quantification of mock microbial communities with metagenomes, 16S rRNA gene amplicons and metaproteomics

Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.

2017-05-12 | PXD006118 | Pride

The effect of inositol hexaphosphate and its hydrolysate on the risk of colorectal cancer and the composition of intestinal microbiota

Project description:Interventions: Case (colorectal cancer) group:a newly diagnosed colorectal cancer( CRC ) by colonoscopy and pathology;Control group:Clinically healthy volunteers with no symptoms or history of intestinal disease(e.g. colonic adenomatous polyps, CRC or inflammatory bowel disease) Primary outcome(s): composition of gut microbiota;intestinal microbial phytase activity;16s rRNA metagenomic sequencing;diet surveys;phytic acid intake Study Design: Case-Control study

| 2667847 | ecrin-mdr-crc

Homo sapiens whole blood infected with Candida spp. (here: Candida tropicalis)

Project description:Homo sapiens fresh whole blood was infected with Candida tropicalis. RNA-pool of both species extracted at 0min (control), 15, 30, 60, 120, 240 min. Samples are rRNA depleted. Measurement of Candida tropicalis gene expression.

2019-07-31 | GSE114178 | GEO

Homo sapiens whole blood infected with Candida spp. (here: Candida parapsilosis)

Project description:Homo sapiens fresh whole blood was infected with Candida parapsilosis. RNA-pool of both species extracted at 0min (control), 15, 30, 60, 120, 240 min. Samples are rRNA depleted. Measurement of Homo sapiens gene expression.

2018-12-26 | GSE114177 | GEO

Homo sapiens whole blood infected with Candida spp. (here: Candida glabrata)

Project description:Homo sapiens fresh whole blood was infected with Candida glabrata. RNA-pool of both species extracted at 0min (control), 15, 30, 60, 120, 240 min. Samples are rRNA depleted. Measurement of Candida glabrata gene expression.

2018-12-26 | GSE114175 | GEO

Homo sapiens whole blood infected with Candida spp. (here: Candida albicans)

Project description:Homo sapiens fresh whole blood was infected with Candida albicans SC5314. RNA-pool of both species extracted at 0min (control), 15, 30, 60, 120, 240 min. Samples are rRNA depleted. Expression measurement of Homo sapiens genes.

2018-12-26 | GSE114174 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data