Triticum aestivum strain:Chinese Spring
Ontology highlight
ABSTRACT:
REPOSITORIES: ENA
Similar Datasets
Project description:To identify aberrant splicing isoforms and potential neoantigens, we performed full-length cDNA sequencing of lung adenocarcinoma cell lines using a long-read sequencer MinION. We constructed a comprehensive catalog of aberrant splicing isoforms and detected isoform-specific peptides using proteome analysis.
2020-12-09 | PXD019915 | JPOST Repository
Project description:To identify full-length cap-to-poly(A) mRNA isoforms of CD20 and rule out reverse transcription artifacts which are common in cDNA-seq approaches, long-read Oxford Nanopore direct RNA sequencing was performed on the Raji cell line.
2023-12-08 | GSE243920 | GEO
Project description:Tuberous sclerosis complex (TSC) is a relatively common autosomal dominant disorder characterized by multiple dysplastic organ lesions and neuropsychiatric symptoms, caused by loss-of-function mutation of either TSC1 or TSC2. Target-capture full-length double-stranded cDNA sequencing using long-read sequencer Nanopore (Nanopore Long-read Target Sequencing) revealed that the various kinds of the TSC1 and TSC2 full-length transcripts and the novel intron retention transcripts of TSC2 in TSC patient. Our results indicate that the Nanopore Long-read Target Sequencing is useful for the detection of mutations and confers information on the full-length alternative splicing transcripts for the genetic diagnosis.
2023-09-04 | GSE241410 | GEO
Project description:MicroRNAs (miRNAs) are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes, namely developmental timing, cell differentiation, cell proliferation, immune response and infection. For this reason, their identification is essential to understand eukaryotic biology. Their small size, low abundance and high instability complicated early identification; however, cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish (Danio rerio). For this, a series of cDNA libraries were prepared from small non-coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted.
2016-03-31 | GSE66718 | GEO
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
2024-10-08 | E-MTAB-14500 | biostudies-arrayexpress