Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Cell-SELEX-AnnexinA2

ABSTRACT: Cell-SELEX identify an aptamer named ACE4 against the Annexin A2

PROVIDER: PRJEB22637 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	ERR2121980.fastq.gz	Fastqsanger.gz
	ERR2121990.fastq.gz	Fastqsanger.gz
	ERR2121981.fastq.gz	Fastqsanger.gz
	ERR2121991.fastq.gz	Fastqsanger.gz
	ERR2121982.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 16

Similar Datasets

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.

2019-12-31 | GSE137006 | GEO

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

A sputum bioassay for airway eosinophilia using an eosinophil peroxidase aptamer

Project description:We genearted a DNA aptamer against EPX via SELEX protocol using a random DNA library and developed an assay to monitor EPX in patients spitum samples After 15 rounds of selection, the aptamer sequences were obtained by high throughput sequencing

2022-09-25 | GSE213923 | GEO

Selection of RNA aptamers against human islets by SELEX and toggle SELEX

Project description:Type 1 Diabetes is still an incurable disease characterized by autoimmune destruction of insulin-producing beta cells within the islet of Langerhans in the pancreas. Currently, there are no methods to monitor beta-cell mass in humans or deliver therapeutics specifically to beta cells. Here we performed Cluster Systematic Evolution of Ligands by Exponential Enrichment (SELEX) experiments and toggle SELEX experiments to identify RNA aptamers specific for human islets. In the cluster SELEX, we started from a random library of RNA nucleotides composed of a 40 nucleotide long variable region flanked by two constant regions. We performed eight selection cycles using hand-picked islets and islet-depleted acinar tissue from 4 cadaveric human donors as positive and negative selectors. In the toggle SELEX, we conducted eight cycles of selection using islets and acinar tissue from mice, followed by two cycles of selection using human tissues. The polyclonal libraries from the two selection strategies showed a convergent evolution of ligands and increased specificity for human islets.

2022-02-23 | GSE197262 | GEO

Expression data of J3T-1, J3T-2, J3T-1shA, J3T-2A glioma

Project description:We have previously established two sibling glioma subclones, J3T-1 and J3T-2, showing distinct invasive and angiogenic phenotypes. J3T-1, expressing high annexin A2, demonstrates robust angiogenesis and tumor invasion around neovasculature. J3T-2, expressing low annexin A2, demonstrates diffuse invasion along white matter tracts. Knockdown of annexin A2 in J3T-1 (J3T-1shA) resulted in diffuse invasion pattern, and overexpression of annexin A2 in J3T-2 (J3T-2A) showed prominent angiogenesis. We used microarrays to identify genes which promote the phenotypic transition regulated by annexin A2.

2020-04-20 | GSE138374 | GEO

SELEX-seq of AP1 homodimer

Project description:These datasets represent the results of a SELEX-seq experiment to identify the DNA binding specificity of Arabidopsis thaliana AP1-AP1 dimers

2025-10-22 | GSE230171 | GEO

Selection of RNA aptamers against human islets by SELEX and toggle SELEX

Project description:Selection of RNA aptamers against human islets by SELEX and toggle SELEX

| PRJNA809588 | ENA

Differential binding cell-SELEX

Project description:Differential binding cell-SELEX: method for identification of cell specific aptamers by high throughput sequencing

| PRJEB28303 | ENA

Annexin A2 Modulates Radiation-Sensitive Transcriptional Programming and Cell Fate

Project description:Whole genome expression profiling in the presence and absence of annexin A2 [shRNA] identified fundamentally altered transcriptional programming that changes the radioresponsive transcriptome. Bioinformatics predicted that silencing AnxA2 may enhance cell death responses to stress in association with reduced activation of pro-survival signals such as nuclear factor kappa B. This prediction was validated by demonstrating a significant increase in sensitivity toward tumor necrosis factor alpha induced cell death in annexin A2 silenced cells, relative to vector controls, associated with reduced nuclear translocation of RelA (p65) following tumor necrosis factor alpha treatment. Murine progenitor cells, JB6 cell line, were stably transformed with Annexin A2 shRNA or vector only control and then treated with ionizing radiation at two doses, 10cGy and 100cGy. Samples were collected at 2hr, 6hr and 24hr for RNA isolation. Two untreated time points were collected also: 2hr and 24hr.

2012-11-28 | E-GEOD-42547 | biostudies-arrayexpress

HT-SELEX of recombinant C2H2 zinc finger domains of Sall4

Project description:To define the sequence preference of SALL4 C2H2 zinc finger domains, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified SALL4 ZFC1, ZFC2 and ZFC4 domains combined with no protein control experiment.

2021-01-05 | E-MTAB-9236 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data