Tameness QTL Sequence Capture
Ontology highlight
ABSTRACT:
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| ERR022076.fastq.gz | Fastqsanger.gz | |||
| ERR022077.fastq.gz | Fastqsanger.gz | |||
| ERR022078.fastq.gz | Fastqsanger.gz | |||
| ERR022079.fastq.gz | Fastqsanger.gz | |||
| ERR022080.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 30 |
Similar Datasets
Project description:DNA double-strand breaks (DSBs) are a prominent source of genetic instability/variability frequently associating genome rearrangements with the capture of ectopic chromosomal sequences (ECSs) at junctions. Homologous recombination (HR) is considered in textbooks as an error-free DSB repair mechanism that protects against genome instability. Contradicting this dogma, we show that silencing the central HR players RAD51 or BRCA2 suppresses the sequence homology-independent capture of ECS at the junctions of distant DSBs, especially in 53BP1-depleted cells. We confirmed the requirement of RAD51 for ECS capture at a genome-wide level through high-throughput genome translocation sequencing.
2022-01-17 | GSE126546 | GEO
Project description:The combination of single-cell RNA sequencing with CRISPR inhibition/activation provides a high-throughput approach to simultaneously study the effects of hundreds if not thousands of gene perturbations in a single experiment. One recent development in CRISPR-based single-cell techniques introduces a feature barcoding technology which allows for the simultaneous capture of mRNA and gRNA from the same cell. This is achieved by introducing a capture sequence, whose complement can be incorporated into each gRNA, and which can be used to amplify these features prior to sequencing. However, with the technology in its infancy, there is little information available on how such experimental parameters can be optimised. To overcome this, we varied the capture sequence, capture sequence position and gRNA backbone to identify an optimal gRNA scaffold for CRISPR-activation gene perturbation studies. We provide a report on our screening approach along with our observations and recommendations for future use.
2021-01-08 | GSE164393 | GEO
Project description:Rachel Brem's QTL yeast strain collection (BY4716 x S288C cross) profiled by full lysate and phospho-enrichment proteomic analysis
2022-05-10 | PXD010893 | Pride
Project description:Functional dissection of QTL-region affecting fat-deposition
2018-10-15 | E-MTAB-1434 | biostudies-arrayexpress
Project description:High-throughput capture of ectopic chromosomal sequence
| PRJNA522302 | ENA
Project description:Targeted sequence capture of Orientia tsutsugamushi DNA from chiggers and humans
| PRJEB39975 | ENA
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Salinity is a major abiotic stress at critical stages of seed germination and seedling establishment. Germination rate (GR) and field emergence rate (FER) are the key traits that determine the basic number of plants stand under field conditions. To explore molecular mechanisms in upland cotton under salt stress, a population of 177 recombinant inbred lines (RILs) and their parents were evaluated for seed germination traits (GP, germination potential; GR; FW, fresh weight; DW, dry weight; GL, germinal length) and seedling traits (FER; SH, seedling height; NL, Number of main stem leaves) in 2016-2018. Based on the linkage map contained 2,859 single nucleotide polymorphism (SNP) and simple sequence repeats (SSR) markers, traits under salt stress (E1) and normal condition, (E2) and the converted relative index (R-value) of three years’ trials were used to map quantitative trait loci (QTL). A total of three QTL and two clusters were detected as salt-tolerant QTL. Three QTL (qGR-Chr4-3, qFER-Chr12-3, qFER-Chr15-1) were detected under salt stress and R-value, which explained phenotypic variance of 9.62%-13.67%, and 4.2%-4.72%, 4.75%-8.96%, respectively. Two clusters (Loci-Chr4-2 and Loci-Chr5-4) harboring the QTL for four germination traits (GR, FER, GL, NL) and six seedling traits (GR, FER, DW, FW, SH, NL) were detected related under salt stress. A total of 691 genes were found in the candidate QTL or clusters. Among them, four genes (Gh_A04G1106, Gh_A05G3246, Gh_A05G3177, Gh_A05G3266) showed expression changes between sensitive and tolerant lines under salt stress, and were assigned as candidate genes in response to salt stress. The consistent salt-tolerance QTL identified in both germination and seedling stages will facilitate new information for cotton breeding.
2022-06-23 | GSE186533 | GEO
Project description:NG Capture-C provides high resolution chromatin conformation capture (3C) interaction maps. NG Capture-C was carried out in erythroid and hESC cells at the Hba, Hbb, Myc, and Slc25a37 locus to generate sequence libraries for analytical software testing.
2020-11-02 | GSE129378 | GEO
Project description:This SuperSeries is composed of the following subset Series: GSE11437: Expression QTL mapping of Toxoplasma gondii genes, Bradyzoite array GSE11514: Expression QTL mapping of Toxoplasma gondii genes, Tachyzoite array Keywords: SuperSeries Refer to individual Series
2008-05-22 | E-GEOD-11515 | biostudies-arrayexpress