Mitochondrial genome sequencing of mosquitoes
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB36702 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| ERR4173030.fastq.gz | Fastqsanger.gz | |||
| ERR4173050.fastq.gz | Fastqsanger.gz | |||
| ERR4173071.fastq.gz | Fastqsanger.gz | |||
| ERR4173081.fastq.gz | Fastqsanger.gz | |||
| ERR4172492.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 17 |
Similar Datasets
Project description:Mosquitoes low coverage genome sequencing
| PRJEB22896 | ENA
Project description:Zika virus genome sequencing directly from field collected mosquitoes
| PRJEB29404 | ENA
Project description:Wolbachia pipientis strain:mosquitoes | isolate:mosquitoes Genome sequencing
| PRJNA524640 | ENA
Project description:Identification of genes associated with bendiocarb resistance. Mosquitoes collected as larvae from Nagongera and Kihihi, Uganda. Bendiocarb-resistant and unexposed female mosquitoes selected using standard WHO tube bioassays. RNA was extracted from pools of five individuals identified as An. gambiae s.s. Insecticide-susceptible mosquitoes from the Kisumu strain were included as controls. RNA hybridized in an interwoven loop design to compare four biological replicates each of resistant, unexposed, and laboratory mosquitoes.
2018-03-28 | E-MTAB-6280 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Pool of mosquitoes from the same species Metagenome
| PRJNA723282 | ENA
Project description:Mitochondrial heteroplasmy, the presence of more than one mtDNA variant in a cell or individual is not as uncommon as previously thought. It is mostly due to the high mutation rate of the mtDNA and limited repair mechanisms present in the mitochondrion. The phenomenon has been studied mostly in human samples and in medical contexts. Heteroplasmy has also been researched in other species in fields such as forensics or genetic foot printing, but these studies usually focused on contained families within closely related species. Here we describe a large cross-species evaluation of heteroplasmy in mammals. We employed a novel approach to detect mitochondrial heteroplasmy in both novel and previously reported ChIP-sequencing datasets, which include concomitant mitochondrial DNA sequenced in the experiment. Here, we report novel ChIP-seq experiments for H3K4me1 and CEBPA across mammals, as well as some H3K4me3, H3K27ac and total histone H3 experiments. Most of the reported CEBPA experiments are good quality pull-downs, however the quality of many of the other experiments reported here has not been interrogated in detail. Whereas this does not affect the investigation of mitochondrial DNA pollution for the purposes of this study, both H3K4me1 and total histone H3 ChIP-seq datasets were often sequenced to relatively low depth and showed low ChIP enrichment compared to the other antibodies.
2016-05-13 | E-MTAB-3933 | biostudies-arrayexpress
Project description:Determination of miRNA profiles in most prominent mosquitoes will determine the potential targets for mosquito control Some of the most medically important viruses, such as dengue virus, West Nile virus, Zika virus, and yellow fever virus, are transmitted by mosquitoes. These aptly named arboviruses impose a tremendous cost to the health of populations around the world. As a result, much effort has gone into the study of the impact of these viruses in human infections. Comparatively less efforts, however, have been made to study the way these viruses interact with mosquitos themselves. It has long been held that these viruses are introduced into the midgut of mosquitoes upon ingestion of a blood meal before being transmitted within the saliva upon subsequent feeding. This sequence requires that the mosquito be able to defend itself from infection every step along the way-from ingesting bloodmeal to subsequent feeding. The main defense mechanisms employed by the mosquitoes to control viruses is RNA interference (RNAi). Modulation of this facet of the mosquito’s immune system would thereby suggest a practical strategy for vector control. This paper will provide an up to date overview of the mosquito’s immune system along with novel data describing miRNA profiles for Aedes aegypti and Culex quinquefasiatus in Grenada, West Indies.
2020-04-29 | GSE149518 | GEO