Evolution of hybrid inviability associated with chromosome fusions
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB69278 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| ERR12329158_1.fastq.gz | Fastqsanger.gz | |||
| ERR12329158_2.fastq.gz | Fastqsanger.gz | |||
| ERR12329159_1.fastq.gz | Fastqsanger.gz | |||
| ERR12329159_2.fastq.gz | Fastqsanger.gz | |||
| ERR12329160_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 12 |
Similar Datasets
Project description:Hybridization of eggs and sperm from closely related species can give rise to genetic diversity, or can lead to embryo inviability due to incompatibility. Although central to evolution, the cellular and molecular mechanisms underlying postzygotic barriers that drive reproductive isolation and speciation remain largely unknown. Species of the African Clawed frog Xenopus provide an ideal system to study hybridization and genome evolution. Xenopus laevis is an allotetraploid with 36 chromosomes that arose through interspecific hybridization of diploid progenitors, whereas Xenopus tropicalis is a diploid with 20 chromosomes that diverged from a common ancestor ~48 million years ago. Differences in genome size between the two species are accompanied by organism size differences, and size scaling of the egg and subcellular structures such as nuclei and spindles formed in egg extracts. Nevertheless, early development transcriptional programs, gene expression patterns, and protein sequences are generally conserved. Interestingly, whereas the hybrid produced when X. laevis eggs are fertilized by X. tropicalis sperm (le×ts) is viable, the reverse hybrid (te×ls) dies prior to gastrulation. Here, we applied cell biological tools and high-throughput methods to study the mechanisms underlying hybrid inviability. We reveal that two specific X. laevis chromosomes are incompatible with the X. tropicalis cytoplasm and are mis-segregated during mitosis, leading to unbalanced gene expression at the maternal to zygotic transition, followed by cell-autonomous catastrophic embryo death.
2017-11-01 | GSE106157 | GEO
Project description:Paternal chromosome loss and metabolic crisis contribute to hybrid inviability in Xenopus
| PRJNA415788 | ENA
Project description:Hybrid phenotypes that contribute to postzygotic reproductive isolation often exhibit pronounced asymmetry, both between reciprocal crosses and between the sexes in accordance with Haldane's rule. Inviability in mammalian hybrids is associated with parent-of-origin placental growth abnormalities for which misregulation of imprinted genes is the leading candidate mechanism. However, direct evidence for the involvement of imprinted genes in hybrid growth dysplasia is limited. We used transcriptome and reduced representation bisulfite sequencing to conduct the first genome-scale assessment of the contribution of imprinted genes to parent-of-origin placental growth dysplasia in the cross between the house mouse (Mus musculus domesticus) and the Algerian mouse (Mus spretus). Imprinted genes with transgressive expression and methylation were concentrated in the Kcnq1 cluster, which contains causal genes for prenatal growth abnormalities in mice and humans. Hypermethylation of the cluster’s imprinting control region, and consequent misexpression of the genes Phlda2 and Ascl2, is a strong candidate mechanism for transgressive placental undergrowth. Transgressive placental and gene regulatory phenotypes, including expression and methylation in the Kcnq1 cluster, were more extreme in hybrid males. While consistent with Haldane’s rule, male-biased defects are unexpected in rodent placenta because the X-chromosome is effectively hemizygous in both sexes. In search of an explanation we found evidence of leaky imprinted (paternal) X-chromosome inactivation in hybrid female placenta, an epigenetic disturbance that may buffer females from the effects of X-linked incompatibilities to which males are fully exposed. Sex differences in chromatin structure on the X and sex-biased maternal effects are non-mutually exclusive alternative explanations for adherence to Haldane’s rule in hybrid placenta. The results of this study contribute to understanding the genetic basis of hybrid inviability in mammals, and the role of imprinted genes in speciation.
2020-11-09 | GSE161051 | GEO
Project description:Using RNA-seq technology, a comprehensive assessment of cis regulatory divergence in interspecific hybrid female heads was conducted and patterns of sequence evolution (Begun et al. 2007) within causal loci were examined. Genotype specific references were shown to virtually eliminate the map bias plaguing this technology. A novel Bayesian model, which uses allele representation in F1 hybrid DNA sequence reads as a prior, was used to estimate allele frequencies in RNA sequences.
2011-12-21 | GSE34591 | GEO
Project description:Genomic surveys of yeast hybrid species isolated from the wild and from human-related environment, aimed at the reconstruction of the natural evolution of Saccharomyces spp. evolution
2016-04-30 | E-SYBR-11 | biostudies-arrayexpress
Project description:Initiation and progression of cancers reflect the underlying process of somatic evolution, which follows a Darwinian logic, i.e., diversification of heritable phenotypes provides a substrate for natural selection, resulting in the outgrowth of the most fit subpopulations. Although somatic evolution can tap into multiple sources of diversification, it is assumed to lack access to (para)sexual recombination – a key diversification mechanism throughout all strata of life. Based on observations of spontaneous fusions involving cancer cells, reported genetic instability of polypoid cells, and precedence of fusion-mediated parasexual recombination in fungi, we asked whether cell fusions could serve as a source of parasexual recombination in cancer cell populations. Using differentially labelled tumor cells, we found evidence of low-frequency, spontaneous cell fusions between carcinoma cells in multiple cell line models of breast cancer both in vitro and in vivo. While some hybrids remained polyploid, many displayed partial ploidy reduction, generating diverse progeny with heterogeneous inheritance of parental alleles, indicative of partial recombination. Hybrid cells also displayed elevated levels of phenotypic plasticity, which may further amplify the impact of cell fusions on the diversification of phenotypic traits. Using mathematical modeling, we demonstrated that the observed rates of spontaneous somatic cell fusions may enable populations of tumor cells to amplify clonal heterogeneity, thus facilitating the exploration of larger areas of the adaptive landscape, relative to strictly asexual populations, which may substantially accelerate a tumor’s ability to adapt to new selective pressures.
2020-09-12 | GSE157845 | GEO
Project description:Initiation and progression of cancers reflect the underlying process of somatic evolution, which follows a Darwinian logic, i.e., diversification of heritable phenotypes provides a substrate for natural selection, resulting in the outgrowth of the most fit subpopulations. Although somatic evolution can tap into multiple sources of diversification, it is assumed to lack access to (para)sexual recombination – a key diversification mechanism throughout all strata of life. Based on observations of spontaneous fusions involving cancer cells, reported genetic instability of polypoid cells, and precedence of fusion-mediated parasexual recombination in fungi, we asked whether cell fusions could serve as a source of parasexual recombination in cancer cell populations. Using differentially labelled tumor cells, we found evidence of low-frequency, spontaneous cell fusions between carcinoma cells in multiple cell line models of breast cancer both in vitro and in vivo. While some hybrids remained polyploid, many displayed partial ploidy reduction, generating diverse progeny with heterogeneous inheritance of parental alleles, indicative of partial recombination. Hybrid cells also displayed elevated levels of phenotypic plasticity, which may further amplify the impact of cell fusions on the diversification of phenotypic traits. Using mathematical modeling, we demonstrated that the observed rates of spontaneous somatic cell fusions may enable populations of tumor cells to amplify clonal heterogeneity, thus facilitating the exploration of larger areas of the adaptive landscape, relative to strictly asexual populations, which may substantially accelerate a tumor’s ability to adapt to new selective pressures.
2020-10-21 | GSE159680 | GEO
Project description:Initiation and progression of cancers reflect the underlying process of somatic evolution, which follows a Darwinian logic, i.e., diversification of heritable phenotypes provides a substrate for natural selection, resulting in the outgrowth of the most fit subpopulations. Although somatic evolution can tap into multiple sources of diversification, it is assumed to lack access to (para)sexual recombination – a key diversification mechanism throughout all strata of life. Based on observations of spontaneous fusions involving cancer cells, reported genetic instability of polypoid cells, and precedence of fusion-mediated parasexual recombination in fungi, we asked whether cell fusions could serve as a source of parasexual recombination in cancer cell populations. Using differentially labelled tumor cells, we found evidence of low-frequency, spontaneous cell fusions between carcinoma cells in multiple cell line models of breast cancer both in vitro and in vivo. While some hybrids remained polyploid, many displayed partial ploidy reduction, generating diverse progeny with heterogeneous inheritance of parental alleles, indicative of partial recombination. Hybrid cells also displayed elevated levels of phenotypic plasticity, which may further amplify the impact of cell fusions on the diversification of phenotypic traits. Using mathematical modeling, we demonstrated that the observed rates of spontaneous somatic cell fusions may enable populations of tumor cells to amplify clonal heterogeneity, thus facilitating the exploration of larger areas of the adaptive landscape, relative to strictly asexual populations, which may substantially accelerate a tumor’s ability to adapt to new selective pressures.
2020-10-21 | GSE159679 | GEO
Project description:We described in this work the reproductive barrier between Capsella rubella and Capsella grandiflora leading to hybrid seed inviability. The transcriptome revealed a similar response to the one observed in interploidy hybrid seeds.
2015-03-28 | GSE67359 | GEO
Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).
2020-10-09 | GSE146481 | GEO