Sex-limited experimental evolution drives transcriptomic divergence in a hermaphrodite
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1012714 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR25898604_1.fastq.gz | Fastqsanger.gz | |||
| SRR25898604_2.fastq.gz | Fastqsanger.gz | |||
| SRR25898605_1.fastq.gz | Fastqsanger.gz | |||
| SRR25898605_2.fastq.gz | Fastqsanger.gz | |||
| SRR25898606_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 48 |
Similar Datasets
Project description:The evolution of gonochorism from hermaphroditism is linked with the formation of sex chromosomes, as well as the evolution of sex-biased and sex-specific gene expression to allow both sexes to reach their fitness optimum. There is evidence that sexual selection drives the evolution of male-biased gene expression in particular. However, previous research in this area in animals comes from either theoretical models or comparative studies of already old sex chromosomes. We therefore investigated changes in gene expression under three different selection regimes for the simultaneous hermaphrodite Macrostomum lignano subjected to sex-limited experimental evolution (i.e., selection for fitness via eggs, via sperm, or a control regime allowing both). After 21 and 22 generations of selection for male-specific or female-specific fitness, we characterized changes in whole-organism gene expression. We found that female-selected lines had changed the most in their gene expression. Although annotation for this species is limited, GO-term and KEGG pathway analysis suggests that metabolic changes (e.g., biosynthesis of amino acids and carbon metabolism) are an important adaptive component. As predicted, we found that expression of genes previously identified as testis-biased candidates tended to be downregulated in the female-selected lines. We did not find any significant expression differences for previously identified candidates of other sex-specific organs, but this may simply reflect that few transcripts have been characterized in this way. In conclusion, our experiment suggests that changes in testis-biased gene expression are important in the early evolution of sex chromosomes and gonochorism.
2023-09-29 | GSE242254 | GEO
Project description:The evolution of gonochorism from hermaphroditism is linked with the formation of sex chromosomes, as well as the evolution of sex-biased and sex-specific gene expression to allow both sexes to reach their fitness optimum. There is evidence that sexual selection drives the evolution of male-biased gene expression in particular. However, previous research in this area in animals comes from either theoretical models or comparative studies of already old sex chromosomes. We therefore investigated changes in gene expression under 3 different selection regimes for the simultaneous hermaphrodite Macrostomum lignano subjected to sex-limited experimental evolution (i.e. selection for fitness via eggs, sperm, or a control regime allowing both). After 21 and 22 generations of selection for male-specific or female-specific fitness, we characterized changes in whole-organism gene expression. We found that female-selected lines had changed the most in their gene expression. Although annotation for this species is limited, gene ontology term and Kyoto Encyclopedia of Genes and Genomes pathway analyses suggest that metabolic changes (e.g. biosynthesis of amino acids and carbon metabolism) are an important adaptive component. As predicted, we found that the expression of genes previously identified as testis-biased candidates tended to be downregulated in the female-selected lines. We did not find any significant expression differences for previously identified candidates of other sex-specific organs, but this may simply reflect that few transcripts have been characterized in this way. In conclusion, our experiment suggests that changes in testis-biased gene expression are important in the early evolution of sex chromosomes and gonochorism.
| S-EPMC10786194 | biostudies-literature
Project description:In the filamentous ascomycete Neurospora tetrasperma, a large (approx. 7 Mbp) region of suppressed recombination surrounds the mating-type (mat) locus. While the remainder of the genome is largely homoallelic, this region of recombinational suppression, extending over 1500 genes, is associated with sequence divergence. Here, we used microarrays to examine how the molecular phenotype of gene expression level is linked to this divergent region, and thus to the mating type. Culturing N. tetrasperma on agar media that induce sexual/female or vegetative/male tissue, we found 196 genes significantly differentially expressed between mat A and mat a mating types. Our data show that the genes exhibiting mat-linked expression are enriched in the region genetically linked to mating type, and sequence and expression divergence are positively correlated. Our results indicate that the phenotype of mat A strains is optimized for traits promoting sexual/female development and the phenotype of mat a strains for vegetative/male development. This discovery of differentially expressed genes associated with mating type provides a link between genotypic and phenotypic divergence in this taxon and illustrates a fungal analogue to sexual dimorphism found among animals and plants.
| S-EPMC3712418 | biostudies-literature
Project description:Regulatory divergence during limb evolution
| PRJNA521485 | ENA
Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).
2020-10-09 | GSE146481 | GEO
Project description:Although not all sex-dependent gene expression is adaptive, it is likely an important genomic mechanism that allows each sex to independently adapt to environmental changes. Among Drosophila species, sex-biased genes display remarkably consistent evolutionary patterns; male-biased genes evolve faster than unbiased genes in both coding sequence and expression level, suggesting sex-differences in selection through time. However, comparatively little is known of the evolutionary process shaping sex-biased expression within species. Latitudinal clines offer an opportunity to examine how changes in key ecological parameters also influence sex-specific selection and the evolution of sex-biased gene expression. We assayed male and female gene expression in Drosophila serrata along a latitudinal gradient in eastern Australia spanning most of its endemic distribution. Analysis of 11,631 genes across eight populations revealed strong sex differences in the frequency, mode, and strength of divergence. Divergence was far stronger in males than females and while latitudinal clines were evident in both sexes, male divergence was often population-specific, suggesting responses to localized selection pressures that do not covary predictably with latitude. While divergence was enriched for male-biased genes, there was no overrepresentation of X-linked genes in males. By contrast, X-linked divergence was elevated in females, especially for female biased genes. Many genes that diverged in D. serrata have homologs also showing latitudinal divergence in D. simulans and D. melanogaster on other continents, likely indicating parallel adaptation in these distantly related species. Our results suggest that sex differences in selection play an important role in shaping the evolution of gene expression over macro- and micro-ecological spatial scales.
2017-01-04 | GSE90733 | GEO
Project description:Background The Pacific oyster Crassostrea gigas (Mollusca, Lophotrochozoa) is an alternative and irregular protandrous hermaphrodite. Little is known about the genetic and phenotypic bases of sex determinism in oysters, and little more about the molecular pathways regulating reproduction. We have recently developed and validated a microarray containing 31,918 oligomers (Dheilly et al., 2011) representing the oyster transcriptome. The application of this microarray to the study of mollusks gametogenesis should provide a better understanding of the key factors involved in sex differentiation and the regulation of oyster reproduction. Results Expression of the 31,918 ESTs was studied in gonads of oysters cultured along the French Atlantic coasts over a yearly reproductive cycle. Principal component analysis and hierarchical clustering first showed a significant divergence in gene expression patterns of males and females beginning when gonial mitosis started. Early expressed male-specific genes included bindin and female-specific genes included foxL2, a pancreatic lipase related protein, cd63 and vitellogenin. ANOVA analysis of the data further revealed 2482 genes differentially expressed during the course of males and/or females gametogenesis. The expression of 434 genes could be localized in either germ cells or somatic cells of the gonad by comparing the transcriptome of gonads to the transcriptomes of striped oocytes and somatic tissues. Analysis of the annotated genes revealed conserved molecular mechanisms between mollusks and mammals. Genes involved in chromatin condensation, DNA replication and repair, mitosis and meiosis regulation, transcription, translation and apoptosis were expressed in both male and female gonads. Additional lists of genes more specifically involved in either spermatogenesis (meiotic phase, in spermatozoids and mature sperm formation and in flagella structure and movement) or oogenesis (female sex differentiation, transcriptional regulation, cell cycle regulation and oocytes maturation) were also generated. Conclusions Our study provides novel insight into spermatogenesis and oogenesis in an alternative hermaphrodite bivalve, the Pacific oyster C. gigas. We identified genes opening new perspectives for functional studies of the signaling pathways implicated in gonad differentiation and development.
2012-12-01 | GSE27955 | GEO
Project description:Tribolium castaneum experimental evolution
| PRJNA552902 | ENA
Project description:To examine the ways in which gene expression varies in natural populations and its relationship to genetic divergence, we estimated allele-specific expression in the offspring of multiple wild C. elegans strains crossed with the laboratory reference strain N2. Allele-specific expression analyses are uniquely sensitively able to identify cis regulatory changes, and coupled with analyses of differential expression between parental strains and parents and offspring can determine the regulatory pattern and inheritance mode of gene expression across the genome. We chose 7 strains that represented a range of divergence from N2 and spanned the species tree to cross with N2: EG4348; DL238; CB4856 (the classical ‘Hawaiian’ strain); ECA722; QX1211; and ECA701 and XZ1516 (two extremely diverged strains). This study sheds light on the relationship of genetic and expression divergence, the global patterns of inheritance and regulatory mode of genes in C. elegans, and the factors that differentiate genes with expression divergence from those with stabler expression.
2024-10-14 | GSE272616 | GEO
Project description:Regulatory divergence during mouse limb evolution
| PRJNA521487 | ENA