Quantification of transcript isoforms at the single-cell level using SCALPEL
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1115197 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR29147789_1.fastq.gz | Fastqsanger.gz | |||
| SRR29147789_2.fastq.gz | Fastqsanger.gz | |||
| SRR29147790_1.fastq.gz | Fastqsanger.gz | |||
| SRR29147790_2.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 4 of 4 |
Similar Datasets
Project description:3' based single-cell RNA sequencing (scRNA-seq) has enabled the study of gene expression at the individual cell level and the development of few methods to quantify transcriptomic variability at the single-cell level. Yet, most of these methods have low sensitivity and specificity. Here, we present SCALPEL, a new tool to quantify and characterize transcript isoforms at the single-cell level using standard 3' based single-cell transcriptomics data. SCALPEL predictions have higher sensitivity than that of other tools and can be validated experimentally. We have used SCALPEL to study the changes in isoform usage during mouse spermatogenesis and in the differentiation of induced pluripotent stem cells (iPSCs) to neural progenitors (NPCs). These analyses confirmed known changes in the 3' UTR length during cell differentiation and allowed the identification of new cell populations and cell type specific microRNA signatures controlling isoform expression in individual cells. Together, our results highlight the importance of isoform quantification to gain insight on the gene regulatory mechanisms at the single-cell level.
2025-06-06 | GSE268222 | GEO
Project description:Long-read RNA sequencing (RNA-seq) holds great potential for characterizing transcriptome variation and full-length transcript isoforms, but the relatively high error rate of current long-read sequencing platforms poses a major challenge. We present ESPRESSO, a computational tool for robust discovery and quantification of transcript isoforms from error-prone long reads. ESPRESSO jointly considers alignments of all long reads aligned to a gene and uses error profiles of individual reads to improve the identification of splice junctions and the discovery of their corresponding transcript isoforms. On both a synthetic spike-in RNA sample and human RNA samples, ESPRESSO outperforms multiple contemporary tools in not only transcript isoform discovery but also transcript isoform quantification. In total, we generated and analyzed ~1.1 billion nanopore RNA-seq reads covering 30 human tissue samples and three human cell lines. ESPRESSO and its companion dataset provide a useful resource for studying the RNA repertoire of eukaryotic transcriptomes.
2022-10-14 | GSE192955 | GEO
Project description:ESPRESSO: Robust discovery and quantification of transcript isoforms from error-prone long-read RNA-seq data
| PRJNA793881 | ENA
Project description:High-throughput sequencing of cDNA (RNA-seq) is used extensively to characterize the transcriptome of cells. Many transcriptomics studies aim at comparing either abundance levels or the transcriptome composition between given conditions, and as a first step, the sequencing reads must be used as the basis for abundance quantification of transcriptomic features of interest, such as genes or transcripts. Several different quantification approaches have been proposed, ranging from simple counting of reads overlapping given genomic regions to more complex estimation of underlying transcript abundances. In this paper, we show that gene-level abundance estimates and statistical inference offer advantages over transcript-level analyses, in terms of both performance and interpretability. We also illustrate that while the presence of differential isoform usage can lead to inflated false discovery rates in differential expression analyses on simple count matrices, and incorporation of transcript-level abundance estimates improves the performance in simulated data, the difference is relatively minor in several real data sets. Finally, we provide an R package (tximport) to help users integrate transcript-level abundance estimates from common quantification pipelines into count-based statistical inference engines.
2015-12-10 | E-MTAB-4119 | biostudies-arrayexpress
Project description:Accurate detection and quantification of mRNA isoforms from nanopore long-read sequencing remains challenged by technical noise, particularly in single cells. To address this, we introduce Isosceles, a computational toolkit that outperforms other methods in isoform detection sensitivity and quantification accuracy across single-cell, pseudo-bulk and bulk resolution levels, as demonstrated using synthetic and biologically-derived datasets. Isosceles improves the fidelity of single-cell transcriptome quantification at the isoform-level, and enables flexible downstream analysis. As a case study, we apply Isosceles, uncovering coordinated splicing within and between neuronal differentiation lineages. Isosceles is suitable to be applied in diverse biological systems, facilitating studies of cellular heterogeneity across biomedical research applications.
2023-11-27 | GSE248115 | GEO
Project description:Accurate detection and quantification of mRNA isoforms from nanopore long-read sequencing remains challenged by technical noise, particularly in single cells. To address this, we introduce Isosceles, a computational toolkit that outperforms other methods in isoform detection sensitivity and quantification accuracy across single-cell, pseudo-bulk and bulk resolution levels, as demonstrated using synthetic and biologically-derived datasets. Isosceles improves the fidelity of single-cell transcriptome quantification at the isoform-level, and enables flexible downstream analysis. As a case study, we apply Isosceles, uncovering coordinated splicing within and between neuronal differentiation lineages. Isosceles is suitable to be applied in diverse biological systems, facilitating studies of cellular heterogeneity across biomedical research applications.
2023-11-27 | GSE248114 | GEO
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.
2016-01-11 | GSE69352 | GEO
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress
Project description:We have adapted a commercial assay that employs mRNA quantification based on the frequency of PCR amplicons determined by next-generation to a high-throughput semi-conductor sequencing platform (Ion-Torrent Proton). We show parallel amplification of pathway derived transcript sets/genes in 12 reference RNA samples followed by sequence-based quantification covering a dynamic range of five orders of magnitude with low technical variation.
2014-07-15 | GSE58737 | GEO
Project description:Quantification of fungal dark matter using qPCR
| PRJEB69215 | ENA