Homo sapiens
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA117507 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Genes regulated after transient knock-down of Pirin in WM-266 cells
| PRJNA118529 | ENA
Project description:Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation. Keywords: Transcriptional regulation, knock-down using shRNA We analyzed gene expression profiles of U937 cells after knock-down of PIR using the shPIR#7 oligonucleotides cloned in the pSICO-R lentiviral vector. No residual PIR protein is detectable in U937-shPIR#7 cells by Western blotting. U937 cells containing the empty cloning vector (U937-pSICO) were used as control. shPIR#7 oligonucleotide sequences: Human PIR#7-for: TGAAGCCACTTTGTCTTAATTTCAAGAGAATTAAGACAAAGTGGCTTCTTTTTTC Human PIR#7-rev: TCGAGAAAAAAGAAGCCACTTTGTCTTAATTCTCTTGAAATTAAGACAAAGTGGCTTCA For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.
2009-12-10 | E-GEOD-16798 | biostudies-arrayexpress
Project description:Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation. Keywords: Transcriptional regulation, knock-down using shRNA
2009-12-10 | GSE16798 | GEO
Project description:Transcription profiling by high throughput sequencing between ASCC3 knock-down cells and control cells
2025-01-24 | E-GEOD-47399 | ExpressionAtlas
Project description:Effect on JNK knock-down in INS-1 insulin-producing cells
2014-12-05 | E-MTAB-3146 | ExpressionAtlas
Project description:Expression analysis of gene expression changes in Homo sapiens SGC-7901 cells after knock down of MTA2 (Metastasis-associated protein) or overexpression SNHG5 (snoRNA host gene 5) Investigation of whole genome gene expression level changes in a Homo sapiens gastric carcinoma cells SGC-7901 after knock down MTA2 expression and upregulation of SNHG5
2015-09-09 | GSE65915 | GEO
Project description:Expression analysis of gene expression changes in Homo sapiens SGC-7901 cells after knock down of MTA2 (Metastasis-associated protein) or overexpression SNHG5 (snoRNA host gene 5) Investigation of whole genome gene expression level changes in a Homo sapiens gastric carcinoma cells SGC-7901 after knock down MTA2 expression and upregulation of SNHG5 A four chip study using total RNA extracted from SGC-7901 cells transfected with siRNA negative control and SGC-7901 cells knock down of MTA2 with siRNA. Each chip measures the expression level of 45033 genes collected from the authoritative data source including NCBI
2015-09-09 | E-GEOD-65915 | biostudies-arrayexpress
Project description:Transcription profiling by array of HEK293 cells after RNAi knock-down of genes in the DNA-damage-induced transcriptional network, treated with neocarzinostatin
2025-01-24 | E-GEOD-1676 | ExpressionAtlas
Project description:RNAi knock down of RNA binding IMP proteins in human epithelial (HeLa) cells
2025-01-22 | E-MEXP-548 | ExpressionAtlas