Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNA-seq analysis of differentially expressed genes between WT and KD ZC3H18 KYSE150/ECA109 cells.

ABSTRACT: RNA-seq analysis of differentially expressed genes between WT and KD ZC3H18 KYSE150/ECA109 cells.

PROVIDER: PRJNA1226578 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR32438681_1.fastq.gz	Fastqsanger.gz
	SRR32438681_2.fastq.gz	Fastqsanger.gz
	SRR32438682_1.fastq.gz	Fastqsanger.gz
	SRR32438682_2.fastq.gz	Fastqsanger.gz
	SRR32438683_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 12

Similar Datasets

RNA-seq analysis of differentially expressed genes between WT and KD ZC3H18 KYSE150/ECA109 cells.

Project description:Small interfering RNAs (siRNAs) targeting ZC3H18 were purchased from Suzhou Hongxun Biotechnology Co., Ltd. (Suzhou, China), with an empty vector serving as the control (si-nc). ZC3H18 siRNA sequences were GGGGTGAGGGCTTCTGATCT and TCGTCGGAGTGATTATCTTCCT. These siRNAs were introduced into KYSE150 and ECA109 cells using DharmaFect1 (Suzhou Hongxun Biotechnology Co., Ltd., Suzhou, China).

2025-02-21 | GSE290209 | GEO

RNA-Seq of PRMT1 overexpression ECA109 cells

Project description:RNA-seq was performed on three biological replicates. Total RNA from ECA109 LV-GFP/LV-PRMT1.Differentially expressed genes were considered to be significant between groups when the P-value was <0.05 and the fold change of expression was ≥2-fold or ≤0.5-fold. By this way, the RNA-Seq data showed the differential expression genes in PRMT1 overexpression ECA109 cells compared with NC cells. Furthermore, Gene ontology (GO) analysis was performed to facilitate elucidating the biological implications of the differentially expressed genes in the experiment. Pathway analysis was used to find out the significant pathway of the differentially expressed genes according to KEGG database. In conclusion, our study represents the first detailed analysis of PRMT1 transcriptomes in esophageal squamous cell carcinoma cells.

2019-05-09 | GSE128913 | GEO

RNA-Seq of LEF1 overexpression ECA109 cells

Project description:RNA-seq was performed on three biological replicates. Total RNA from ECA109 LV-GFP/LV-LEF1.Differentially expression genes were considered to be significant between groups when the P-value was <0.05 and the fold change of expression was ≥2-fold or ≤0.5-fold. By this way, the RNA-Seq data showed the differential expression genes in LEF1 overexpression ECA109 cells compared with NC cells. Furthermore, Gene ontology (GO) analysis was performed to facilitate elucidating the biological implications of the differentially expressed genes in the experiment. Pathway analysis was used to find out the significant pathway of the differentially expressed genes according to KEGG database. In conclusion, our study represents the first detailed analysis of LEF1 transcriptomes in esophageal squamous cell carcinoma cells.

2020-04-10 | GSE128914 | GEO

differentially expressed proteins (DEPs) at the blastocyst stage in the Hspa2-KD and NC groups by applying proteomics technology

Project description:To further investigate the mechanism underlying the ability of HSPA2 to influence cell fate during early embryonic development, we next analyzed differentially expressed proteins (DEPs) at the blastocyst stage in the Hspa2-KD and NC groups by applying proteomics technology.

2025-03-08 | PXD052193 | Pride

ESCC KYSE150 cells: TPA treatment vs. control

Project description:Complete lncRNA and mRNA expression profile of ESCC KYSE150 cells and TPA-treatment KYSE150 cells

2024-02-01 | GSE167247 | GEO

Differentially expressed genes following ARID1A depletion

Project description:Differentially expressed genes following ARID1A depletion

| PRJNA477786 | ENA

Differentially expressed miRNAs in colorectal cancer

Project description:Differentially expressed miRNAs in colorectal cancer

| PRJNA658901 | ENA

RNA-seq of Eca109 cells.

Project description:RNA-seq of Eca109 cells.

| PRJNA876710 | ENA

RNA-sequencing analysis of the KYSE150 cells overexpressing caspase-8 mutants (M4, M6, M10, M13) or wild-type caspase-8

Project description:Purpose: Next-generation sequencing (NGS) has revolutionized systems-based analysis of cellular pathways. The goals of this study are using RNA sequencing analysis to test the effects of overexpressing caspase-8 mutants or wild-type caspase-8 on the mRNA of KYSE150 cells. Methods: KYSE150 cells were transfected with caspase-8 mutants or wild-type caspase-8 for 48 hours in 1640 medium plus 10% serum. Two independent replicates were plated, transfected in parallel for each caspase-8 mutants or wild-type caspase-8. Results: Log-fold changes of mRNAs between caspase-8 mutants and wild-type caspase-8 group were selected with a significance threshod of p<0.05. There are 3974 overlapping differentially expressed genes in the caspase-8 mutant cells compared to the wild-type caspase-8 cells. Conclusions: Our study determined the mRNA changes of caspase-8 mutant KYSE150 cells compared to the wild-type caspase-8 cells.

2022-03-17 | GSE198569 | GEO

Identification of differentially expressed circRNAs in OLF

Project description:Identification of differentially expressed circRNAs in OLF

| PRJNA416002 | ENA