Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1229152 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR32506600_1.fastq.gz | Fastqsanger.gz | |||
| SRR32506600_2.fastq.gz | Fastqsanger.gz | |||
| SRR32506601_1.fastq.gz | Fastqsanger.gz | |||
| SRR32506601_2.fastq.gz | Fastqsanger.gz | |||
| SRR32506602_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 24 |
Similar Datasets
Project description:Samples of oil and production water were collected from five wells of the Qinghai Oilfield, China, and subjected to GeoChip hybridization experiments for microbial functional diversity profiling. Unexpectedly, a remarkable microbial diversity in oil samples, which was higher than that in the corresponding water samples, was observed, thus challenging previously believed assumptions about the microbial diversity in this ecosystem. Hierarchical clustering separated oil and water samples, thereby indicating distinct functional structures in the samples. Genes involved in the degradation of hydrocarbons, organic remediation, stress response, and carbon cycling were significantly abundant in crude oil, which is consistent with their important roles in residing in oil. Association analysis with environmental variables suggested that oil components comprising aromatic hydrocarbons, aliphatic hydrocarbons, and a polar fraction with nitrogen-, sulfur-, and oxygen-containing compounds were mainly influential on the structure of the microbial community. Furthermore, a comparison of microbial communities in oil samples indicated that the structures were depth/temperature-dependent. To our knowledge, this is the first thorough study to profile microbial functional diversity in crude oil samples.
2016-04-01 | GSE55293 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Samples of oil and production water were collected from five wells of the Qinghai Oilfield, China, and subjected to GeoChip hybridization experiments for microbial functional diversity profiling. Unexpectedly, a remarkable microbial diversity in oil samples, which was higher than that in the corresponding water samples, was observed, thus challenging previously believed assumptions about the microbial diversity in this ecosystem. Hierarchical clustering separated oil and water samples, thereby indicating distinct functional structures in the samples. Genes involved in the degradation of hydrocarbons, organic remediation, stress response, and carbon cycling were significantly abundant in crude oil, which is consistent with their important roles in residing in oil. Association analysis with environmental variables suggested that oil components comprising aromatic hydrocarbons, aliphatic hydrocarbons, and a polar fraction with nitrogen-, sulfur-, and oxygen-containing compounds were mainly influential on the structure of the microbial community. Furthermore, a comparison of microbial communities in oil samples indicated that the structures were depth/temperature-dependent. To our knowledge, this is the first thorough study to profile microbial functional diversity in crude oil samples. From the Qinghai Oilfield located in the Tibetan Plateau, northwest China, oil production mixtures were taken from four oil production wells (No. 813, 516, 48 and 27) and one injection well (No. 517) in the Yue-II block. The floating oil and water phases of the production mixtures were separated overnight by gravitational separation. Subsequently, the microbial community and the characteristics of the water solution (W813, W516, W48, and W27) and floating crude oil (O813, O516, O48, and O27) samples were analyzed. A similar analysis was performed with the injection water solution (W517).
2016-04-01 | E-GEOD-55293 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO