Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1257859 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.
2024-03-01 | GSE254843 | GEO
Project description:Rumen bioreactor food waste Raw sequence reads
| PRJNA984243 | ENA
Project description:Food waste is a major source of environmental pollution, as its landfills attribute to greenhouse gas emissions. This study developed a robust upcycling bioprocess that converts food waste into lactic acid through autochthonous fermentation and further produces biodegradable polymer polyhydroxybutyrate (PHB). Food can be stored without affecting its bioconversion to lactic acid, making it feasible for industrial application. Mapping autochthonous microbiota in the food waste fermentation before and after storage revealed lactic-acid-producing microorganisms dominate during the indigenous fermentation. Furthermore, through global transcriptomic and gene set enrichment analyses, it was discovered that coupling lactic acid as carbon source with ammonium sulfate as nitrogen source in Cupriavidus necator culture upregulates pathways, including PHB biosynthesis, CO2 fixation, carbon metabolism, pyruvate metabolism, and energy metabolism compared to pairing with ammonium nitrate. There was ∼90 % PHB content in the biomass. Overall, the study provides crucial insights into establishing a bioprocess for food waste repurposing.
2025-06-16 | GSE296860 | GEO
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride
Project description:Anaerobic digestion is a popular and effective microbial process for waste treatment. The performance of anaerobic digestion processes is contingent on the balance of the microbial food web in utilizing various substrates. Recently, co-digestion, i.e., supplementing the primary substrate with an organic-rich co-substrate has been exploited to improve waste treatment efficiency. Yet the potential effects of elevated organic loading on microbial functional gene community remains elusive. In this study, functional gene array (GeoChip 5.0) was used to assess the response of microbial community to the addition of poultry waste in anaerobic digesters treating dairy manure. Consistent with 16S rRNA gene sequences data, GeoChip data showed that microbial community compositions were significantly shifted in favor of copiotrophic populations by co-digestion, as taxa with higher rRNA gene copy number such as Bacilli were enriched. The acetoclastic methanogen Methanosarcina was also enriched, while Methanosaeta was unaltered but more abundant than Methanosarcina throughout the study period. The microbial functional diversity involved in anaerobic digestion were also increased under co-digestion.
2017-01-12 | GSE93419 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Bioreactor food waste conversion to carboxylic acids Raw sequence reads
| PRJNA1111930 | ENA
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride