Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1262816 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Chloroplast Genomic Analysis of Typhonium flagelliforme
| PRJNA1052430 | ENA
Project description:Typhonium flagelliforme cultivar:Serpong Transcriptome or Gene expression
| PRJNA1141733 | ENA
Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for PCR amplification were selected upstream from EcoRI site (coordinate 30487 in the sequence with Accession number U13369.1): 5' TTCGCCTACGGATTTCTAGAAAATAA 3' and 5' AAAAGAAGCTCAAGTACATCTAATCTAA 3' (new primers).
2022-12-01 | GSE121363 | GEO
Project description:To investigate the specificity of the Tn5 transposome with short adaptor DNAs under the non-crosslinked condition, we conducted ATAC-seq using alternative 19 bp adaptor DNAs (IE and OE) harboring 7 nucleotide differences between them (Maggie.JMB.1998), which allowed for specific PCR amplification without losing the superior enzymatic activity.
2022-05-01 | GSE144449 | GEO
Project description:As transposon sequencing (TnSeq) assays have become prolific in the microbiology field, it is of interest to scrutinize their potential drawbacks. TnSeq results are determined by counting transposon insertions following the PCR-based enrichment and subsequent deep sequencing of transposon insertions. Here we explore the possibility that PCR amplification of transposon insertions in a TnSeq library skews the results by introducing bias into the detection and/or enumeration of insertions. We compared the detection and frequency of mapped insertions when altering the number of PCR cycles in the enrichment step. In addition, we devised and validated a novel, PCR-free TnSeq method where the insertions are enriched via CRISPR/Cas9-targeted transposon cleavage and subsequent Oxford Nanopore sequencing. These PCR-based and PCR-free experiments demonstrate that, overall, PCR amplification does not significantly bias the results of the TnSeq assay insofar as insertions in the majority of genes represented in our library were similarly detected regardless of PCR cycle number and whether or not PCR amplification was employed. However, the detection of a small subset of genes which had been previously described as essential is indeed sensitive to the number of PCR cycles. We conclude that PCR-based enrichment of transposon insertions in a TnSeq assay is reliable but researchers interested in profiling essential genes should carefully weigh the number of amplification cycles employed in their library preparation protocols. In addition, we present a PCR-free TnSeq alternative that is comparable to traditional PCR-based methods although the latter remain superior owing to their accessibility and high sequencing depth.
2020-12-21 | GSE162988 | GEO
Project description:Field-grown tubers of potato were examined for infection by Tobacco rattle virus and consequent production of corky ringspot or spraing symptoms. A microarray study identified tuber genes that are differentially expressed in response to TRV infection and to spraing production, showing that hypersensitive response (HR) pathways are activated in spraing-symptomatic tubers. This was confirmed by quantitative RT-PCR (Q-RT-PCR) of a selected group of HR-related genes and by histochemical staining of excised tuber tissue with spraing symptoms. Q-RT-PCR of TRV in different areas of the same tuber slice showed that non-symptomatic areas contained higher levels of virus than did spraing-symptomatic areas. This suggests that spraing formation is associated with an active plant defence that reduces the level of virus in the infected tuber. Expression of two plant defence genes was similarly upregulated in spraing-symptomatic tubers that were infected with another virus, Potato mop-top-virus, suggesting that spraing is a generalised response to virus infection of tubers.
2016-11-15 | E-MTAB-4670 | biostudies-arrayexpress
Project description:The study sought to determine the global miRNA profile of ventricles during early and end-stage hypertrophic cardiomyopathy in a severe double mutant mouse model of the disease. MicroRNA expression profiles of ventricles of transgenic mice with a mutation in both the myosin heavy chain gene (MYH7 Arg403Gln) and cardiac troponin I gene (TNNI3 Ser203Gln) and of non-transgenic mice were determined using Rodent TaqMan Low Density miRNA Arrays A v2.0 (TLDA, Life Technologies). MicroRNA profiles were measured at 10 days of age and 16 days of age, in 3 biological replicates. qRT-PCR analysis of microRNAs of ventricles of three transgenic mice and three non-transgenic mice age 10 days, and three transgenic mice and three non-transgenic mice age 16 days. 450 ng RNA was reverse transcribed, without pre-amplification, using TaqMan MicroRNA Reverse Transcription Kit and Megaplex RT Primers rodent pool A (Life Technologies). Complementary DNA (cDNA) was amplified using a TaqMan rodent microRNA A Array v2.0 (Life Technologies) with TaqMan Universal PCR Master Mix on an ABI 7900HT Sequence Detection System.
2012-05-11 | E-GEOD-37692 | biostudies-arrayexpress