Homo sapiens Mus musculus
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1310217 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Off-target (OT) analysis of different guide RNAs targeting PKLR gene. GUIDE-Seq analyses were done in HEK293 cells stably expressing Cas9 transfected with gRNA complexes, generated using Alt-R® CRISPR-Cas9 crRNA XT and Alt-R®CRISPR-Cas9 tracrRNA, and transfected with a dsODN tag
2021-04-13 | GSE171935 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Compact and versatile CRISPR-Cas systems will enable genome engineering applications through high-efficiency delivery in a wide variety of contexts. Here we create an efficient miniature Cas system (CasMINI) engineered from the type V-F Cas12f (Cas14) system by guide RNA and protein engineering, which is less than half the size of currently used CRISPR systems (Cas9 or Cas12a). We demonstrate that CasMINI can drive high levels of gene activation (up to thousands-fold increases), while the natural Cas12f system fails to function in mammalian cells. We show that the CasMINI system has comparable activities to Cas12a for gene activation, is highly specific, and allows for robust base editing and gene editing. We expect that CasMINI can be broadly useful for cell engineering and gene therapy applications ex vivo and in vivo.
2021-09-10 | GSE180773 | GEO
Project description:Analysis by LC-MS/MS shotgun proteomics was performed on lysates from the following samples: 1) Control HK2 cells generated using control CRISPR/CAS9 system and scrambled guide RNA (sgRNAGCACTCACATCGCTACATCA) 2) HK2 cells with FTO knockout using CRISPR/Cas9 system and target 2 guide RNA (sgCCTACAAGTACCTGAACACC) 3) HK2 cells with FTO knockout using CRISPR/Cas9 system and target 3 guide RNA (sgCCAGGCTCTTTACGGTCCCC) 4) HK2 cells treated with vehicle control 5) HK2 cells treated with erastin 6) HK2 cells treated with FTO inhibitor FB23-2
2025-10-13 | PXD051362 | Pride
Project description:A longstanding barrier in genome engineering with CRISPR-Cas9 has been the inability to measure Cas9 edit outcomes at single-cell resolution. Here we present Superb-seq, a new technology for joint measurement of on-target and off-target Cas9 edits and transcriptomes by single-cell RNA sequencing. In contrast to Perturb-seq methods that read each cell’s guide RNA, Superb-seq directly reads Cas9 edits by leveraging T7 in situ transcription. We performed Superb-seq on 9,500 K562 cells, targeting four chromatin remodeler genes with seven guide RNAs. Superb-seq identified 11,891 edit events in 6,230 edited cells at all seven on-target sites and at 36 off-target sites. One notable off-target edit fell within the first intron of the deubiquitinase gene USP9X, which decreased its expression and perturbed the expression of downstream genes. Superb-seq uses off-the-shelf kits, standard equipment, and requires no virus, which will enable CRISPR screens in virus-intolerant cell types and functional characterization of off-target events.
2025-02-25 | GSE284207 | GEO
Project description:Single-cell lineage tracing based on CRISPR/Cas9 gene editing enables the simultaneous linkage of cell states and lineage history at a high resolution. Despite its immense potential in resolving the cell fate determination and genealogy within an organism, existing implementations of this technology suffers from the limitations in recording capabilities and considerable information dropout. Here, we introduce a versatile tool, DuTracer, which utilizes two orthogonal gene editing systems to record deep cell lineage history at single-cell resolution in an inducible manner. DuTracer shows the ability of enhanced lineage recording with minimized target dropouts and deepened tree depth. Application of DuTracer in mouse embryoid bodies and neuromesodermal organoids illustrates the transition pattern of the lineage relationship of different cell types and proposes potential lineage-biased molecular drivers. Moreover, we have developed an entropy-based approach to quantify the lineage recording ability of DuTracer in cell differentiation models. Together, DuTracer facilitates the precise and regulatory interrogation of cellular lineages of complex biological processes.
2024-11-20 | GSE261211 | GEO
Project description:This study investigates the RNA targets and cleavage sites of endogenous Cas9 in the food-borne pathogen Campylobacter jejuni. Direct RNA binding targets of Cas9 in C. jejuni strain NCTC11168 were determined using RIP-seq. The Cleavage sites were then predicted in the RNA targets by comparing total transcriptome data from WT and deletion (cas9, crRNA3, tracrRNA, CRISPR-tracrRNA) strains. PAMs for the CjeCas9 were enriched using the PAM-SCANR platform, which operates through a GFP reporter gene. Upon GFP (and thus functional PAM) enrichment, fluorescing cells were isolated using FACS and prepared plasmid DNA was amplified and prepared for sequencing.
2018-03-01 | GSE106849 | GEO
Project description:The aim of the experiment is to assess the robustness of CRISPR-Cas9 based genetic engineering. Using RNA sequencing, we are able to quantify the abundance of transcripts corresponding to CRISPR-targets and thus the degree of nonsense mediated decay.
2019-08-22 | E-MTAB-7061 | biostudies-arrayexpress
Project description:In this study the RNA targetome of the endonuclease Cas9, the trans-activating crRNA (tracrRNA) and a CRISPR-associated small RNA (scaRNA/NMnc0040) was determined in Neisseria meninigitidis serogroup C strain 8013 by RNA-seq.
2025-10-04 | GSE214843 | GEO
Project description:Assess the on- and off-target effects of dox-inducible CRISPR/Cas9 and CRISPRi constructs in a human iPS cell line. Transcript quantification of 3 cell lines, each plus or minus doxycycline and with or without specific single guide RNAs (sgRNAs), with 2 biological replicates each.
2016-01-19 | E-GEOD-76980 | biostudies-arrayexpress