Cooler temperatures destabilize RNA interference and increase susceptibility of disease vector mosquitoes to viral infection
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA214946 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR950407.fastq.gz | Fastqsanger.gz | |||
| SRR950408.fastq.gz | Fastqsanger.gz | |||
| SRR950409.fastq.gz | Fastqsanger.gz | |||
| SRR950410.fastq.gz | Fastqsanger.gz | |||
| SRR950411.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 8 |
Similar Datasets
Project description:The impact of global climate change on the transmission dynamics of infectious diseases is the subject of extensive debate. The transmission of mosquito-borne viral diseases is particularly complex, with climatic variables directly affecting many parameters associated with the prevalence of disease vectors. While evidence shows that warmer temperatures often decrease the extrinsic incubation period of an arthropod-borne virus (arbovirus), exposure to cooler temperatures often predisposes disease vector mosquitoes to higher infection rates. RNA interference pathways are essential to antiviral immunity in the mosquito; however, few experiments have explored the effects of temperature on the RNAi machinery. Total small RNAs (miRNAs, siRNAs, piRNAs, etc.) were isolated and sequenced from the heads of sensor strain Aedes aegypti mosquitoes, or from the whole bodies of CHIKV-infected Aedes albopictus mosquitoes 8 hours post infection. Mosquitoes were grown at 18C or 28C in replicates of 1 (Ae. aegypti) or 3 (Ae. albopictus).
2013-08-13 | E-GEOD-46204 | biostudies-arrayexpress
Project description:The impact of global climate change on the transmission dynamics of infectious diseases is the subject of extensive debate. The transmission of mosquito-borne viral diseases is particularly complex, with climatic variables directly affecting many parameters associated with the prevalence of disease vectors. While evidence shows that warmer temperatures often decrease the extrinsic incubation period of an arthropod-borne virus (arbovirus), exposure to cooler temperatures often predisposes disease vector mosquitoes to higher infection rates. RNA interference pathways are essential to antiviral immunity in the mosquito; however, few experiments have explored the effects of temperature on the RNAi machinery.
2013-08-13 | GSE46204 | GEO
Project description:BackgroundThe impact of global climate change on the transmission dynamics of infectious diseases is the subject of extensive debate. The transmission of mosquito-borne viral diseases is particularly complex, with climatic variables directly affecting many parameters associated with the prevalence of disease vectors. While evidence shows that warmer temperatures often decrease the extrinsic incubation period of an arthropod-borne virus (arbovirus), exposure to cooler temperatures often predisposes disease vector mosquitoes to higher infection rates. RNA interference (RNAi) pathways are essential to antiviral immunity in the mosquito; however, few experiments have explored the effects of temperature on the RNAi machinery.Methodology/principal findingsWe utilized transgenic "sensor" strains of Aedes aegypti to examine the role of temperature on RNA silencing. These "sensor" strains express EGFP only when RNAi is inhibited; for example, after knockdown of the effector proteins Dicer-2 (DCR-2) or Argonaute-2 (AGO-2). We observed an increase in EGFP expression in transgenic sensor mosquitoes reared at 18°C as compared with 28°C. Changes in expression were dependent on the presence of an inverted repeat with homology to a portion of the EGFP sequence, as transgenic strains lacking this sequence, the double stranded RNA (dsRNA) trigger for RNAi, showed no change in EGFP expression when reared at 18°C. Sequencing small RNAs in sensor mosquitoes reared at low temperature revealed normal processing of dsRNA substrates, suggesting the observed deficiency in RNAi occurs downstream of DCR-2. Rearing at cooler temperatures also predisposed mosquitoes to higher levels of infection with both chikungunya and yellow fever viruses.Conclusions/significanceThis data suggest that microclimates, such as those present in mosquito breeding sites, as well as more general climactic variables may influence the dynamics of mosquito-borne viral diseases by affecting the antiviral immunity of disease vectors.
| S-EPMC3667787 | biostudies-literature
Project description:Mosquito-borne flaviviruses maintain life cycles in mammals and mosquitoes. RNA interference (RNAi) has been demonstrated as an anti-flavivirus mechanism in mosquitoes; however, whether and how flavivirus induces and antagonizes RNAi-mediated antiviral immunity in mammals remains unknown. Here we showed that NS2A of Dengue virus-2 (DENV2) act as a viral suppressor of RNAi (VSR). When NS2A-mediated RNAi suppression was disabled, the resulting mutant DENV2 induced Dicer-dependent production of abundant DENV2-derived siRNAs in differentiated mammalian cells. Importantly, VSR-disabled DENV2 showed severe replication defects in mosquito and mammalian cells, and mice, which were rescued by the deficiency of RNAi. Moreover, NS2As of multiple flaviviruses act as VSRs in vitro and during viral infection in both organisms. Overall, our findings demonstrate that antiviral RNAi can be induced by flavivirus, while flavivirus uses NS2A as bona fide VSR to evade RNAi in mammals and mosquitoes, highlighting the importance of RNAi in flaviviral vector-host life cycles.
2020-02-24 | GSE133284 | GEO
Project description:Wolbachia pipientis strain:mosquitoes | isolate:mosquitoes Genome sequencing
| PRJNA524640 | ENA
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Pool of mosquitoes from the same species Metagenome
| PRJNA723282 | ENA
Project description:Plasmodium parasites within mosquitoes are exposed to various physiological processes, such as blood meal digestion activity, the gonotrophic cycle, and host responses preventing the entry of parasites into the midgut wall. However, when in vitro-cultured ookinetes are injected into the hemocoel of mosquitoes, Plasmodium parasites are not affected by the vertebrate host’s blood contents and do not pass through the midgut epithelial cells. This infection method might aid in identifying mosquito-derived factors affecting Plasmodium development within mosquitoes. This study investigated novel mosquito-derived molecules related to parasite development in Anopheles mosquitoes. We injected in vitro-cultured Plasmodium berghei (ANKA strain) ookinetes into female and male Anopheles stephensi (STE2 strain) mosquitoes and found that the oocyst number was significantly higher in males than in females, suggesting that male mosquitoes better support the development of parasites. Next, RNA-seq analysis was performed on the injected female and male mosquitoes to identify genes exhibiting changes in expression. Five genes with different expression patterns between sexes and greatest expression changes were identified as being potentially associated with Plasmodium infection. Two of the five genes also showed expression changes with infection by blood-feeding, indicating that these genes could affect the development of Plasmodium parasites in mosquitoes.
2024-05-06 | GSE197159 | GEO