Homo sapiens
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA252938 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR1422081.fastq.gz | Fastqsanger.gz | |||
| SRR1422082.fastq.gz | Fastqsanger.gz | |||
| SRR1422083.fastq.gz | Fastqsanger.gz | |||
| SRR1422084.fastq.gz | Fastqsanger.gz | |||
| SRR1422085.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 9 |
Similar Datasets
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress
Project description:Acetaminophen (APAP) is a commonly used analgesic responsible for more than half of acute liver failure cases. Identification of previously unknown genetic risk factors would provide mechanistic insights and novel therapeutic targets for APAP-induced liver injury. This study used a genome-wide CRISPR-Cas9 screen to evaluate genes that are protective against, or cause susceptibility to, APAP-induced liver injury. HuH7 human hepatocellular carcinoma cells containing CRISPR-Cas9 gene knockouts were treated with 15mM APAP for 30 minutes to 4 days. A gene expression profile was developed based on the 1) top screening hits, 2) overlap of expression data from APAP overdose studies, and 3) predicted affected biological pathways. We further demonstrated the implementation of intermediate time points for the identification of early and late response genes. This study illustrated the power of a genome-wide CRISPR-Cas9 screen to systematically identify novel genes involved in APAP-induced hepatotoxicity and to provide potential targets to develop novel therapeutic modalities.
2019-02-04 | GSE112463 | GEO
Project description:Docetaxel chemotherapy in metastatic prostate cancer offers only a modest survival benefit due to emerging resistance. To identify candidate therapeutic gene targets, we applied a murine prostate cancer orthograft model that recapitulates clinical invasive prostate cancer in a genome-wide CRISPR/Cas9 screen under docetaxel treatment pressure.
2020-10-07 | E-MTAB-9482 | biostudies-arrayexpress
Project description:CRISPR/Cas9 Screens Reveal Epstein-Barr virus Synthetic Lethal Targets
| PRJNA361554 | ENA
Project description:The ability to perturb genes in human cells is crucial for elucidating gene function and holds great potential for finding therapeutic targets for diseases such as cancer. To extend the catalog of human core and context- dependent fitness genes, we have developed a high-complexity second-generation genome-scale CRISPR-Cas9 gRNA library and applied it to fitness screens in five human cell lines. Using an improved Bayesian analytical approach, we consistently discover 5-fold more fitness genes than were previously observed. We present a list of 1,580 human core fitness genes and describe their general properties. Moreover, we demonstrate that context-dependent fitness genes accurately recapitulate pathway-specific genetic vulnerabilities induced by known oncogenes and reveal cell-type-specific dependencies for specific receptor tyrosine kinases, even in oncogenic KRAS backgrounds. Thus, rigorous identification of human cell line fitness genes using a high-complexity CRISPR-Cas9 library affords a high-resolution view of the genetic vulnerabilities of a cell. Additional data can be found at tko.ccbr.utoronto.ca RNAseq of five human cell lines with Cas9 knock-ins.
2015-11-25 | E-GEOD-75189 | biostudies-arrayexpress
Project description:Gene expression profiling of immortalized human mesenchymal stem cells with hTERT/E6/E7 transfected MSCs. hTERT may change gene expression in MSCs. Goal was to determine the gene expressions of immortalized MSCs.
2010-09-25 | GSE24338 | GEO
Project description:To search for factors regulating neuronal differentiation, we performed a genome-wide loss-of-function CRISPR/Cas9 screen in haploid human ESCs. The regulators were identified by the quantification of depletion of their mutant clones within a pooled loss-of-function library upon neuronal differentiation.
2024-01-12 | E-MTAB-11944 | biostudies-arrayexpress
Project description:Genome-wide CRISPR-Cas9 knockout screen using TKOv1 sgRNA library performed in isogenic RBM10-proficient and RBM10-deficient HCC827 cells.
2024-03-01 | E-MTAB-13626 | biostudies-arrayexpress
Project description:Genome-wide CRISPR-Cas9 knockout screen using TKOv1 sgRNA library was performed in isogenic RBM10-proficient and RBM10-deficient HCC827 cells.
2023-03-04 | E-MTAB-12724 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress