Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression profiling and occupancy after knockdown or over-expression of HFN1A or HNF4G in prostate cancer cells

ABSTRACT: Expression profiling and occupancy after knockdown or over-expression of HFN1A or HNF4G in prostate cancer cells

PROVIDER: PRJNA338783 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR4025870.fastq.gz	Fastqsanger.gz
	SRR4025880.fastq.gz	Fastqsanger.gz
	SRR4025890.fastq.gz	Fastqsanger.gz
	SRR4025900.fastq.gz	Fastqsanger.gz
	SRR4025930.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 45

Similar Datasets

HNF4G, AR, FOXA1, H3K4me1, H3K27acetyl binding sites upon knockdown and overexpression of HNF4G in 22Rv1 and LNCaP prostate cancer cells respectively

Project description:HNF4G is a gastrointestinal tissue enriched master transcriptional regulator seen overexpressed in a subset of prostate cancer. Here we have mapped binding sites of HNF4G, AR, Foxa1, H3K4me1, H3K27acetyl upon knockdown and overexpression of HNF4G in in 22Rv1 and LNCaP cells respectively

2017-11-01 | GSE85558 | GEO

Gene expression profile of LNCaP prostate cancer cells with exogenous HNF4G expression

Project description:To determine genes regulated by HNF4G, we retrovirally infected LNCaP cells in triplicates to express HNF4G and empty vector as control. cDNA for HNF4G in pDONR201 vector was obtained from Harvard medical school Plasmid database (ID:HsCD00022314) and was cloned into an murine stem cell virus (MSCV)-based retroviral vector with puromycin selection marker (Addgene) using Gateway technology.

2017-11-01 | GSE85244 | GEO

Expression profiling and occupancy after knockdown or over-expression of HFN1A or HNF4G in prostate cancer cells

Project description:This SuperSeries is composed of the SubSeries listed below.

2017-11-01 | GSE85559 | GEO

Expression profile of 22Rv1 cells with GFP or HNF4G exogenous expression when treated with BETi ABBV-075

Project description:To study the consequence of HNF4G target genes expression with ABBV-075 treatment in cells that have BETi-independent HNF4G expression, we performed RNA-Seq on 22Rv1 cells that exogenously express HNF4G using GFP expression as control.

2025-01-18 | GSE254733 | GEO

HNF4G and FOXA1 are context-specific drivers of pancreatic cancer progression

Project description:Despite recent advances in the treatment of pancreatic adenocarcinoma (PDAC), clinical outcome remains poor. Previous evidence linked the pioneer transcription factor FOXA1 as a mediator of new regulatory elements that drive tumour progression in models of late-stage disease. Given the critical role of FOXA1 as a pioneer factor for nuclear receptor (NR) transcription factors (TF) in breast and prostate cancer (Estrogen Receptor and Androgen Receptor), we hypothesised that FOXA1 might function with a NR in PDAC (1) (2). Using RIME, our unbiased approach for discovering endogenous protein complexes, we identified HNF4A and HNF4G as reproducible, FOXA1-associated proteins, a finding that was validated in clinical samples of PDAC. Using complex and diverse PDAC models, we show that gene transcription in the classical subtype of pancreatic cancer is regulated by FOXA1/GATA5/6 and HNF4G. We show that HNF4G drives primary disease, in part by recruiting the methyltransferase PRMT1 to regulatory regions. In primary tumour context, HNF4G is the dominant protein and the presence of HNF4G masks FOXA1 activity, resulting in FOXA1 being present, but functionally redundant in primary disease. During transition to metastasis however, HNF4G expression decreases, which unmasks FOXA1 activity, where it becomes transcriptionally active and a subsequent driver of metastasis. We provide new molecular insight into the key TFs in PDAC and the stage-specific activity of these proteins.

2025-08-13 | PXD045980 | Pride

Expression profile of LNCaP/AR cells with or without HNF4G expression grown for long term in charcoal stripped-serum (CSS) media

Project description:To study the underlying mechanism of androgen independent growth we performed transcriptome analysis of LNCaP/AR-Vec and LNCaP/AR-HNF4G at day 9 of growth in CSS and LNCaP/AR-HNF4G at 32 days of growth in CSS to identify the HNF4G transcriptome, as well as determinants of castration-resistant growth

2017-11-01 | GSE85557 | GEO

Gene expression profile of doxycycline inducible shHNF4G hairpins in 22RV1 prostate cancer cells

Project description:To determine genes regulated by HNF4G, we performed doxycycline induced shRNA mediated knockdown of HNF4G using two lentiviral constructs as well as a scrambled shRNA in duplicate. Two pLKO.1 constructs against HNF4G (HNF4Gsh1: TRCN0000019243, targeting CACCAGCATCTCTCCAAACAA in coding DNA sequence (CDS); and HNF4Gsh2: TRCN0000420190, targeting GATGAGCTGGTTAGACCATTTC in CDS) were purchased from Sigma Aldrich MISSION® shRNA Plasmid DNA and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after doxycycline treatment and gene expression profiling was performed.

2017-11-01 | GSE85242 | GEO

Gene expression profiling and H3K9ac occupancy in Nedd4 knockdown Hep3B cells

Project description:Gene expression profiling and H3K9ac occupancy in Nedd4 knockdown Hep3B cells

| PRJNA276569 | ENA

BRD4 ChIP-Seq in 22Rv1 cells exogenously expressing HNF4G or GFP

Project description:BRD4 ChIP-Seq in 22Rv1 cells exogenously expressing HNF4G or GFP

2025-01-18 | GSE254869 | GEO

HNF4G and FOXA1 are context-specific drivers of pancreatic cancer progression [ATAC-seq]

Project description:Despite recent advances in the treatment of pancreatic adenocarcinoma (PDAC), clinical outcome remains poor. Previous work identified the pioneer transcription factor FOXA1 as a mediator of new regulatory elements that drive tumour progression in models of late-stage disease. Given the critical role of FOXA1 as a pioneer factor for nuclear receptor (NR) transcription factors (TF) in breast and prostate cancer (Estrogen Receptor and Androgen Receptor), we hypothesised that FOXA1 might function with a NR in PDAC. Using RIME, our unbiased approach for discovering endogenous protein complexes, we identified HNF4A and HNF4G as reproducible, FOXA1-associated proteins, a finding that was validated in clinical samples of PDAC. Using complex and diverse PDAC models, we show that gene transcription in the classical subtype of pancreatic cancer is regulated by FOXA1/GATA5/6 and HNF4G. We show that HNF4G drives primary disease, in part by recruiting the methyltransferase PRMT1 to regulatory regions. In a primary tumour context, HNF4G is the dominant protein and the presence of HNF4G masks FOXA1 activity, resulting in FOXA1 being present, but functionally redundant in primary disease. During the transition to metastasis however, HNF4G expression decreases, which unmasks FOXA1 activity, where it becomes transcriptionally active and a subsequent driver of metastasis. We provide new molecular insight into the key TFs in PDAC and the stage-specific activity of these proteins.

2025-09-16 | GSE245730 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data