Integrated multi-omics approach reveals a role of ALDH1A1 in lipid metabolism in human colon cancer cells
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA495397 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR7990270.fastq.gz | Fastqsanger.gz | |||
| SRR7990280.fastq.gz | Fastqsanger.gz | |||
| SRR7990290.fastq.gz | Fastqsanger.gz | |||
| SRR7990300.fastq.gz | Fastqsanger.gz | |||
| SRR7990310.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 56 |
Similar Datasets
Project description:Purpose: Next-generation sequencing (NGS) has revolutionized systems-based analysis of cellular pathways. An integrated systems approach was used with bioinformatics tools to understand the the role of aldehyde dehydrogenase 1A1 (ALDH1A1) in human colon cancer cells. We combined transcriptomics, proteomics and untargeted metabolomics to gain insight into the mechanisms affected by the suppression of the ALDH1A1 gene in COLO320 cells Methods: COLO 320 cells. Cellular ALDH1A1 expression was suppressed using MISSION shRNA lentiviral transduction particles containing validated ALDH1A1 shRNA in a pLKO plasmid vector. Scramble control shRNA in pLKO plasmid vector was used to generate control cells. Signal intensities were converted to individual base calls during a run using the system's Real Time Analysis (RTA) software. Primary analysis sample de-multiplexing and alignment to the human genome was performed using Illumina's CASAVA 1.8.2 software suite. The reads were trimmed for quality and aligned with the hg19 reference genome using TopHat2. The transcripts were assembled using Cufflinks. The assembled transcripts were used to estimate transcript abundance and differential gene expression using Cuffdiff. The results were visualized using R (CRAN) and CummeRbund Results: We combined transcriptomics, proteomics and untargeted metabolomics to gain insight into the mechanisms affected by the suppression of the ALDH1A1 gene in COLO320 cells. RNA-seq and proteomics analyses revealed 1747 transcripts and 336 proteins that were differentially expressed in cells in which the ALDH1A1 had been suppressed by shRNA transfection. Transcriptomics pathway analysis showed significant signaling pathways, such as Wnt/β-catenin (p=3.47E-6), molecular mechanisms of cancer (7.41E-5) and others relevant to lipid metabolism, such as cholesterol biosynthesis I, II and III (p=1.82E-4). Proteomics pathway analysis identified oxidative phosphorylation to be the most highly significant pathway (p=5.01E-31). Pathway analysis of the genes common to the transcriptomics and proteomics analyses revealed the asparagine biosynthesis (p=3.16E-3) and cholesterol biosynthesis the most statistically significant (p=3.36E-3). Univariate analysis of the untargeted metabolomics dataset revealed 859 ions statistically significant. Network analysis showed alterations in pathways linked to energy and lipid metabolism, such carnitine shuttle (p=5.3E-4) and fatty acid oxidation (p=2.9E-2). A systems biology approach was used to integrate all three datasets and a total of 61 pathways were generated. A direct association between the suppression of ALDH1A1 and the Vitamin A (retinol) metabolism pathway and downregulation of retinol and the UGT2B17, UGT2A3 and PRDX6 genes was shown Conclusions: the present results confirm the role of ALDH1A1 in retinol metabolism and shows for the first time the influence of this gene on lipid metabolism pathways that may be crucial for cholesterol synthesis in human colon cancer cells. In addition, they demonstrate how an integrated systems approach using unbiased bioinformatics tools can be used to understand the interplay of cellular pathways.
2019-10-08 | GSE121043 | GEO
Project description:An integrated systems approach was used with bioinformatics tools to understand the the role of aldehyde dehydrogenase 1A1 (ALDH1A1) in human colon cancer cells. We combined transcriptomics, proteomics and untargeted metabolomics to gain insight into the mechanisms affected by the suppression of the ALDH1A1 gene in COLO320 cells. RNA-seq and proteomics analyses revealed 1747 transcripts and 336 proteins that were differentially expressed in cells in which the ALDH1A1 had been suppressed by shRNA transfection. Transcriptomics pathway analysis showed significant signaling pathways, such as Wnt/β-catenin (p=3.47E-6), molecular mechanisms of cancer (7.41E-5) and others relevant to lipid metabolism, such as cholesterol biosynthesis I, II and III (p=1.82E-4). Proteomics pathway analysis identified oxidative phosphorylation to be the most highly significant pathway (p=5.01E-31). Pathway analysis of the genes common to the transcriptomics and proteomics analyses revealed the asparagine biosynthesis (p=3.16E-3) and cholesterol biosynthesis the most statistically significant (p=3.36E-3). Univariate analysis of the untargeted metabolomics dataset revealed 859 ions statistically significant. Network analysis showed alterations in pathways linked to energy and lipid metabolism, such carnitine shuttle (p=5.3E-4) and fatty acid oxidation (p=2.9E-2). A systems biology approach was used to integrate all three datasets and a total of 61 pathways were generated. A direct association between the suppression of ALDH1A1 and the Vitamin A (retinol) metabolism pathway and down-regulation of retinol and the UGT2B17, UGT2A3 and PRDX6 genes was shown. In conclusion, the present results confirm the role of ALDH1A1 in retinol metabolism and shows for the first time the influence of this gene on lipid metabolism pathways that may be crucial for cholesterol synthesis in human colon cancer cells. In addition, they demonstrate how an integrated systems approach using unbiased bioinformatics tools can be used to understand the interplay of cellular pathways.
2021-09-08 | PXD012230 | Pride
Project description: Not available
| S-EPMC7988342 | biostudies-literature
Project description:Transcriptome expression changes after knockdown of ALDH1A1 in human colon cancer cells HT29
| PRJNA937679 | ENA
Project description:Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.
2024-08-27 | GSE225822 | GEO
Project description:The goal of this study was to identify preadipocyte signature genes that are dependent in aldehyde dehydrogenase 1a1 (Aldh1a1) by comparison genomes of the immortalized wild type and Aldh1a1-/- preadipocytes. Gene expression was measured using theAffymetrix GeneChip Mouse Gene ST 2.0 arrays. Murine wild type (n=3, control) and Aldh1a1-/- preadipocytes (n=3) were cultured in standard DMEM medium containing 10% of calf serum. mRNA was isolated by RNeasy (Qiagen, Valencia, CA). RNA integrity was interrogated using the Agilent 2100 Bioanalyzer (Agilent Technologies). A 100ng aliquot of total RNA was linearly amplified. Then, 5.5ug of cDNA was labeled and fragmented using the GeneChip WT PLUS reagent kit (Affymetrix, Santa Clara, CA) following the manufacturer's instructions. Labeled cDNA targets were hybridized to Affymetrix GeneChip Mouse Gene ST 2.0 arrays for 16 h at 45 °C rotating at 60rpm. The arrays were washed and stained using the Fluidics Station 450 and scanned using the GeneChip Scanner 3000. Signal intensities were quantified by Affymetrix Expression Console version 1.3.1. Background correction and quantile normalization was performed to adjust technical bias, and probe-set expression levels were calculated by RMA method. After filtering above noise cutoff, there are 9,528 probe-sets that were tested by linear model. A variance smoothing method with fully moderated t-statistic was employed for this study and was adjusted by controlling the mean number of false positives. With a combined cutoff of 2-fold change and p-value of 0.0001 (controlling 1 false positive over all probe-sets), we declared 500 probe-sets as differential gene expression between Aldh1a1-/- and WT preadipocytes.
2016-07-03 | E-GEOD-69573 | biostudies-arrayexpress
Project description:To explore potential impact of Aldh1a1 deficiency in the retinoic acid signaling in the lung, gene expression levels were compared between wildtype and Aldh1a1 deficient lung tissues. The expression levels of retinoic acid responsive genes were very similar between wildtype and Aldh1a1 deficient lungs, suggesting that Aldh1a1 deficiency has minimal impact on retinoic acid signaling.
2024-09-16 | GSE267105 | GEO
Project description:The goal of this study was to identify preadipocyte signature genes that are dependent in aldehyde dehydrogenase 1a1 (Aldh1a1) by comparison genomes of the immortalized wild type and Aldh1a1-/- preadipocytes. Gene expression was measured using theAffymetrix GeneChip Mouse Gene ST 2.0 arrays.
2016-01-01 | GSE69573 | GEO
Project description:Integrated multi-omics approach revealed cellular senescence landscape
| PRJNA865031 | ENA
Project description:To explore potential impact of Aldh1a1 deficiency in the retinoic acid signaling in the lung, gene expression levels were compared between wildtype and Aldh1a1 deficient lung tissues. The expression levels of retinoic acid responsive genes were very similar between wildtype and Aldh1a1 deficient lungs, suggesting that Aldh1a1 deficiency has minimal impact on retinoic acid signaling.
2025-05-06 | GSE296445 | GEO