Gene expression data from bladder cancer patient-derived cells treated with shRNA targeting ALDH1A1
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA508623 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:To examine the role of ALDH1A1 in bladder cancer ｐａｔｉｅｎｔ-derived cells (PDCs), BC-1 and -2 cells were treated with shRNA targeting ALDH1A1 (shALDH1A1) or control shRNA (shControl). ALDH1A1 knockdown study showed that TUBB3 is one of the downregulated genes in PDCs.
2021-12-06 | GSE123396 | GEO
Project description:ELOVL6 is a member of mammalian fatty acid elongase family responsible for converting C16 saturated and monounsaturated fatty acids into C18 species. To investigate the role of ELOVL6 in human bladder cancer, we generated RT112 cells (a human bladder cancer cell line) infected with lentivirus expressing either an shRNA targeting ELOVL6 (shE6) or a scrambled shRNA (shCtrl). The aim of this experiment was to assess the effects of ELOVL6 knockdown on the transcriptome of human bladder cancer cells.
2025-06-02 | GSE290017 | GEO
Project description:Background The primary impediment to the success of immunotherapy lies in the immune evasion orchestrated by tumors, contributing to the suboptimal overall response rates observed. Despite this recognition, the intricacies of the underlying mechanisms remain incompletely understood. Methods and Results Through preliminary detection of clinical patient tissues, we have found that ALDH1A1 was a key gene for the prognosis of cancer patients and tumor glycolysis. In vitro experiments and tumor formation in nude mice suggested that targeting ALDH1A1 could inhibit tumor growth. Through further analysis of xenograft tumor models in immune-normal mice and flow cytometry, we found that deficiency in ALDH1A1 could promote immune system suppression of tumors in vivo. Specifically, RNA-seq analysis, combined with qPCR and western blot, identified the transcription factor ZBTB7B as downstream of ALDH1A1. The binding sites of the transcription factor ZBTB7B on the LDHA promoter region, which is responsible for regulating the rate-limiting enzyme gene LDHA in glycolysis, were determined using luciferase reporter gene detection and Chip-qPCR, respectively. In addition, the increased SUMOylation of ZBTB7B stabilized its transcriptional activity. Further in vivo and in vitro experiments confirmed that the combination of targeting ALDH1A1 and ZBTB7B with immune checkpoint inhibitors could synergistically inhibit tumors in vivo. Finally, after conducting additional verification of patient tissue and clinical data, we have confirmed the potential translational value of targeting ALDH1A1 and ZBTB7B for tumor immunotherapy. Conclusions These results emphasize the potential translational significance of targeting ALDH1A1 and ZBTB7B in the realm of tumor immunotherapy. The convergence of ALDH1A1 inhibition and immune checkpoint blockade, particularly with PD-L1/PD-1 mAb, presents a compelling avenue for curtailing tumor immune escape.
2024-08-27 | GSE269935 | GEO
Project description:Time point (H0, H24, H72) expression data from an EBV cell line obtained from a Fanconi Anemia patient (FANCA) transduced with a control shRNA (sh Ctrl) (n=3) or a shRNA targeting p53 (sh p53) (n=3) and treated with a brief MMC pulse.
2012-10-23 | E-MTAB-1099 | biostudies-arrayexpress
Project description:Aberrant activation of FGFR3 via overexpression or mutation is a frequent feature of bladder cancer; however, its molecular and cellular consequences and functional relevance to carcinogenesis are not well understood. In this study with a bladder carcinoma cell line expressing inducible FGFR3 shRNAs, we sought to identiy transcriptional targets of FGFR3 and investigate their contribution to bladder cancer development. Bladder cancer cell line RT112 was transduced with a doxycycline-inducible control EGFP shRNA or three independent FGFR3 shRNAs, designated FGFR3 shRNA 2-4, FGFR3 shRNA 4-1 and FGFR3 shRNA 6-16. These four cell lines were treated with or without doxycycline for 48 hr to deplete FGFR3 protein prior to the isolation of mRNA for microarray analysis. Genes that were differentially expressed after doxycycline induction in all three FGFR3-depleted cell lines but not in the control cell line were considered potential FGFR3-regulated genes. Each treatment group was run in triplcates, and there are 24 samples.
2012-11-07 | E-GEOD-41035 | biostudies-arrayexpress
Project description:Autism patient derived SHANK2BY29X mutation affects ALDH1A1 negative dopamine neuron development
| PRJNA1078417 | ENA
Project description:Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.
2024-08-27 | GSE225822 | GEO
Project description:MiRnome profiling of Human bladder cancer line invalidated for the MUC4 gene by ShRNA.
2022-08-29 | GSE137130 | GEO
Project description:The metastatic melanoma cell line A375SM was stably transduced with NFAT 1 shRNA utilizing the pSIH-HI- 5 copGFP lentiviral vector. A non-targeting (NT) shRNA construct with no known homology to any human gene was was created and transduced into A375SM cells as a control. These two sets of cells were then subjected to microarray profiling using the Human OneArray microarray (version HOA 6.1, GEO Platform GPL19137) from Phalanx Biotech Group. NFAT shRNA A375SM cells vs. NT-shRNA A375SM cells were subjected to microarray analysis. 3 biological replicates for each cell type were used.
2016-01-06 | E-GEOD-76541 | biostudies-arrayexpress
Project description:Purpose: Next-generation sequencing (NGS) has revolutionized systems-based analysis of cellular pathways. An integrated systems approach was used with bioinformatics tools to understand the the role of aldehyde dehydrogenase 1A1 (ALDH1A1) in human colon cancer cells. We combined transcriptomics, proteomics and untargeted metabolomics to gain insight into the mechanisms affected by the suppression of the ALDH1A1 gene in COLO320 cells Methods: COLO 320 cells. Cellular ALDH1A1 expression was suppressed using MISSION shRNA lentiviral transduction particles containing validated ALDH1A1 shRNA in a pLKO plasmid vector. Scramble control shRNA in pLKO plasmid vector was used to generate control cells. Signal intensities were converted to individual base calls during a run using the system's Real Time Analysis (RTA) software. Primary analysis sample de-multiplexing and alignment to the human genome was performed using Illumina's CASAVA 1.8.2 software suite. The reads were trimmed for quality and aligned with the hg19 reference genome using TopHat2. The transcripts were assembled using Cufflinks. The assembled transcripts were used to estimate transcript abundance and differential gene expression using Cuffdiff. The results were visualized using R (CRAN) and CummeRbund Results: We combined transcriptomics, proteomics and untargeted metabolomics to gain insight into the mechanisms affected by the suppression of the ALDH1A1 gene in COLO320 cells. RNA-seq and proteomics analyses revealed 1747 transcripts and 336 proteins that were differentially expressed in cells in which the ALDH1A1 had been suppressed by shRNA transfection. Transcriptomics pathway analysis showed significant signaling pathways, such as Wnt/β-catenin (p=3.47E-6), molecular mechanisms of cancer (7.41E-5) and others relevant to lipid metabolism, such as cholesterol biosynthesis I, II and III (p=1.82E-4). Proteomics pathway analysis identified oxidative phosphorylation to be the most highly significant pathway (p=5.01E-31). Pathway analysis of the genes common to the transcriptomics and proteomics analyses revealed the asparagine biosynthesis (p=3.16E-3) and cholesterol biosynthesis the most statistically significant (p=3.36E-3). Univariate analysis of the untargeted metabolomics dataset revealed 859 ions statistically significant. Network analysis showed alterations in pathways linked to energy and lipid metabolism, such carnitine shuttle (p=5.3E-4) and fatty acid oxidation (p=2.9E-2). A systems biology approach was used to integrate all three datasets and a total of 61 pathways were generated. A direct association between the suppression of ALDH1A1 and the Vitamin A (retinol) metabolism pathway and downregulation of retinol and the UGT2B17, UGT2A3 and PRDX6 genes was shown Conclusions: the present results confirm the role of ALDH1A1 in retinol metabolism and shows for the first time the influence of this gene on lipid metabolism pathways that may be crucial for cholesterol synthesis in human colon cancer cells. In addition, they demonstrate how an integrated systems approach using unbiased bioinformatics tools can be used to understand the interplay of cellular pathways.
2019-10-08 | GSE121043 | GEO