Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
Project description:Type 1 Diabetes is still an incurable disease characterized by autoimmune destruction of insulin-producing beta cells within the islet of Langerhans in the pancreas. Currently, there are no methods to monitor beta-cell mass in humans or deliver therapeutics specifically to beta cells. Here we performed Cluster Systematic Evolution of Ligands by Exponential Enrichment (SELEX) experiments and toggle SELEX experiments to identify RNA aptamers specific for human islets. In the cluster SELEX, we started from a random library of RNA nucleotides composed of a 40 nucleotide long variable region flanked by two constant regions. We performed eight selection cycles using hand-picked islets and islet-depleted acinar tissue from 4 cadaveric human donors as positive and negative selectors. In the toggle SELEX, we conducted eight cycles of selection using islets and acinar tissue from mice, followed by two cycles of selection using human tissues. The polyclonal libraries from the two selection strategies showed a convergent evolution of ligands and increased specificity for human islets.
Project description:Expanding healthy life expectancy requires technologies for continuous and non-invasive health monitoring. Sensors detecting health-related biomarkers in urine can be used for such applications. DNA aptamers targeting equol, a gut microbiota–derived metabolite with various health benefits, were obtained by Capture-SELEX to construct the aptamer-based equol sensors.
Project description:Despite the well-established significance of transcription factors (TFs) in pathogenesis, their utilization as pharmacological targets has been limited by the inherent challenges mainly associated with modulating their protein-protein and protein-DNA interactions. The lack of defined small-molecule binding pockets and the nuclear localization of TFs makes neither small molecule inhibitors nor neutral antibodies suitable in blocking TF interactions. Aptamers are short oligonucleotides exhibiting high affinity and specificity for a diverse range of targets. The large molecular weights, expansive blocking surfaces and efficient cellular internalization make aptamers as a compelling molecular tool for traditional TF interaction modulators. Here, we report a structure-guided design strategy called Blocker-SELEX for developing inhibitory aptamers (iAptamer) that selectively block TF interactions. Our approach led to the discovery of an iAptamer that cooperatively disrupts SCAF4/SCAF8-RNA Polymerase II (RNAP2) interactions, thus dysregulates RNAP2 dependent gene expression and splicing, leading to the impairing of cell proliferation. This approach was further applied to develop iAptamers efficiently block WDR5-MYC interaction. Together, our study highlights the potential of Blocker-SELEX in developing iAptamers that effectively disrupt TF interactions, and the generated iAptamers hold promising implications as chemical tools in studying biological functions of TF interactions and the potential for nucleic acids drug development.
Project description:Target specific short single-stranded DNA (ssDNA) molecules, called aptamers, are auspicious ligands for numerous in vivo applications. However, aptamers are synthetic molecules, which might be recognized by the immune cells in vivo and induce an activation of the innate immune system. Thus, immune activation potential of synthetic ssDNA oligonucleotides (ODNs) was determined using a well established closed-loop circulation model. Fresh human blood was incubated at 37°C for 2 or 4 hours with ssDNA ODNs (SB_ODN) or CpG ODN as positive control. Transcriptional changes were determined by microarray analyses. Blood samples containing SB_ODN demonstrated after 4 hours a significant regulation of 295 transcripts. Amongst others, CCL8, CXCL10, CCL7 and CXCL11 were highest regulated genes. Gene Ontology terms and KEGG pathway analyses exhibited that the differentially expressed genes belong to the transcripts that are regulated during an immune and inflammatory response, and were overrepresented in TLR signaling pathway. This study shows for the first time the potential of aptamers to activate immune system after systemic application into the human blood. Thus, we highly recommend performing of these preclinical tests with potential aptamer-based therapeutics. To evaluate the influence of synthetic ssDNA oligonucleotides (SB_ODN, CpG_ODN) on the cells of circulating peripheral blood (n=3), the samples were divided into 7 groups, 0h_without ssDNA, 2h_without ssDNA, 2h_with SB_ODN, 2h_with CpG_ODN, 4h_without ssDNA, 4h_with SB_ODN, 4h_with CpG_ODN. Baseline value samples (0h_without ssDNA) were obtained after blood collection without rotating in the closed-loop model. Negative control samples (2h_without ssDNA and 4h_without ssDNA) did not include oligonucleotides but rotated in the closed-loop model.
Project description:Thromboembolic diseases are commonly associated with thrombus-induced ischemia and tissue damage; identification of the location of the thrombus, or thrombus-targeting, may facilitate diagnosis and target therapy. We hypothesized that aptamers with high affinity and specificity for coagulation factor XIII (FXIII) can serve as thrombus-targeting probes. With systematic evolution of ligands by exponential enrichment technology and semi-activated FXIII (FXIII’) as the target, guanine-rich FXIII’-binding aptamers (FAs; 76 nt) were selected from a library of single-stranded DNA. Next generation sequencing identified FAs with the highest frequency; bio-layer interferometry revealed a dissociation constant (Kd) from 0.7 to 2.5 nM. Truncation with preservation of a conserved region based on entropy analysis resulted in three truncated FAs (FATs; 41-47 nt) that exhibited 4-fold signal in binding to activated vs. resting platelets, as determined by flowcytometry. In addition, FAT2 exhibited up to 4.2-fold binding of that from scrambled ssDNA to platelet/fibrin clot or whole blood clot in vitro, suggesting binding to both activated plateltes and fibrin. FAT2 also exhibited targeting effects in a microcirculatory thrombosis model in mice. Nevertheless, FATs induced no effect on blood coagulation, as determined by thromboelastometry. In conclusion, FXIII-binding aptamers are potentially amenable to thrombus targeting in theranostic application of thromboembolic diseases.