Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Seawater

ABSTRACT: Seawater 16S amplicon sequencing

PROVIDER: PRJNA577349 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR10273076_1.fastq.gz	Fastqsanger.gz
	SRR10273076_2.fastq.gz	Fastqsanger.gz
	SRR10273077_1.fastq.gz	Fastqsanger.gz
	SRR10273077_2.fastq.gz	Fastqsanger.gz
	SRR10273078_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 16

Similar Datasets

16s RNA sequencing data from environmental and steel corrosion samples, Shoreham Harbour, UK

Project description:16s RNA gene sequencing data from seawater, bed sediment and steel corrosion samples from Shoreham Harbour, UK, collected to allow bacterial species comparisons between microbially influenced corrosion, the surrounding seawater, and the sea bed sediment at the seafloor and 50cm depth below seafloor.

2019-10-06 | E-MTAB-8373 | biostudies-arrayexpress

Seawater samples

Project description:16S Amplicon Metagenomic Sequencing

| PRJNA823745 | ENA

seawater metagenome

Project description:16S rRNA amplicon sequencing of eDNA collected from seawater near Sesoko Island, Okinawa

| PRJDB11347 | ENA

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Seawater

Project description:Seawater 16s rRNA sequencing raw sequence reads

| PRJNA1277134 | ENA

Soil Metaproteomics LC-MS

Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.

2022-03-01 | PXD009773 | Pride

Effect of photoperiod and seawater tranfer on transcriptome of saccus vasculosus from Atlantic salmon

Project description:Atlantic salmon (Salmo salar) move from fresh- to seawater environments following a seasonally timed preparative transition called smoltification, which takes place under photoperiodic control in the freshwater environment. In masu salmon (Oncorhynchus masou), coordination of photoperiodic sexual maturation is proposed to involve in a fish-specific circumventricular organ, the saccus vasculosus (SV), through its intrinsic opsin-based light sensitivity, thyrotrophin secretion and modulation of deiodinase activity (TSH-DIO cascade). The saccus vasculosus is a highly vascularized structure located on the ventral side of the hypothalamus and its interface between the blood and cerebrospinal fluid also hints at a role in ionic balance of the cerebrospinal fluid (CSF). Both the potential photoperiodic and ionic functions of the SV led us to perform transcriptome analysis of the SV in smoltification in Atlantic salmon. Our data show that SV response to seawater exposure is highly dependent on photoperiodic history and identifies ependymin as a major secretory output of the SV, consistent with a role in control of CSF composition. Conversely, we could not detect crucial elements of the opsin-TSH-DIO cascade suggesting that the photoperiodic history-dependence of the SV to seawater exposure is unlikely to stem from SV-intrinsic responses to photoperiod.

2025-03-16 | GSE291612 | GEO

Metaproteomes of Seawater Microbial Communities from a Wastewater Exposure Experiment

Project description:A short-term microcosm experiment was conducted to evaluate the impact of wastewater discharge on coastal microbial communities. Coastal seawater was exposed to two types of treated wastewater: (i) unfiltered wastewater, containing nutrients, pollutants, and allochthonous microbes, and (ii) filtered wastewater, which retained only nutrients and pollutants while removing microbial components. Metaproteomic samples were collected from the coastal seawater prior to the experiment and from each experimental flask at the late exponential growth phase to assess microbial functional responses to wastewater exposure.

2025-05-09 | PXD061573 | Pride

Transcriptional response to seawater acidification and hyperthermal stress in the azooxanthellate octocoral, Scleronephthya gracillimum

Project description:The soft coral Scleronephthya gracillimum is an azooxanthellate octocoral order Alcyonacea. In this study, stress responses to increased seawater temperature and marine acidification were investigated using a microarray. The S. gracillimum microarray was constructed. The S. gracillimum microarray was constructed after RNA-seq. Oligonucleotides were picked from UniGene of S. gracillimum and the clones were annotated using Blast.

2021-07-24 | GSE180633 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data