Ontology highlight
ABSTRACT:
PROVIDER: PRJNA772700 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR16480713_1.fastq.gz | Fastqsanger.gz | |||
| SRR16480713_2.fastq.gz | Fastqsanger.gz | |||
| SRR16480714_1.fastq.gz | Fastqsanger.gz | |||
| SRR16480714_2.fastq.gz | Fastqsanger.gz | |||
| SRR16480715_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 120 |
Similar Datasets
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage.
2015-03-04 | GSE61099 | GEO
Project description:To uncover, in an unbiased fashion, which elements of the 18 kb translocated region control EVI1 transcription, we devised a CRISPR/Cas9-based enhancer scanning approach. We considered all possible sgRNA target sites containing a canonical Cas9 PAM site (NGG) on both strands of the minimal 18 kb translocated region. Deep-sequencing libraries were generated by PCR amplification of sgRNA guide strands using primers that tag the product with standard Illumina adapters and a 4 bp sample barcode in a 2 step-PCR protocol.
2021-07-26 | E-MTAB-9948 | biostudies-arrayexpress
Project description:Deep learning approaches for scaffolding such functional sites without needing to prespecify the fold or secondary structure of the scaffold. The first approach, “constrained hallucination,” optimizes sequences such that their predicted structures contain the desired functional site. The second approach, “inpainting,” starts from the functional site and fills in additional sequence and structure to create a viable protein scaffold in a single forward pass through a specifically trained RoseTTAFold network.
2023-05-10 | BIOMD0000001071 | BioModels
Project description:We report using global regulator libraries based on the CRISPR-enabled trackable genome engineering (CREATE) method to engineer tolerance against multiple inhibitors in Escherichia coli. Deep mutagenesis libraries were rationally designed, constructed, and screened to target 34,340 mutations across 23 global regulators.These libraries were divided into G1, G2, G3, G4 and G5 sub-groups according to different gene functions (such as active sites, DNA binding sites, and predicted functional sites) . And we successively screened the libraries under different stress conditions (acetate, NaCl, furfural, high temperature and isobutanol), and enriched mutants able to tolerate multiple inhibitors. In order to determine the tolerance-conferring mutations screened under different stress conditions, deep sequencing and fitness analysis were used to detect the recombinant strains with good performance.
2024-04-01 | GSE200448 | GEO
Project description:We want to obtained miRNA-seq from 4 day-old broccoli sprouts by deep sequencing and identified the binding sites of the those miRNAs in human target genes. Meanwhile, we extracted the human target genes from published paper that were regulated by broccoli and compared those genes with the predicted human targets of 4-day broccoli sprouts.
2020-02-01 | E-MTAB-7155 | biostudies-arrayexpress
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress