Homo sapiens
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA792997 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR17634900.fastq.gz | Fastqsanger.gz | |||
| SRR17634900_1.fastq.gz | Fastqsanger.gz | |||
| SRR17634900_2.fastq.gz | Fastqsanger.gz | |||
| SRR17635000.fastq.gz | Fastqsanger.gz | |||
| SRR17635000_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 789 |
Similar Datasets
Project description:Among the 865,918 probes in the Illumina DNA methylation arrays MethylationEPIC BeadChip, a total of 183,509 probes (21.2%) were selected as high-confidence array probes in the crab-eating macaque. Subsequent comparisons revealed that the data from these probes showed good concordance with other DNA methylation datasets of the crab-eating macaque. The selected high-confidence array probes would be useful for high-throughput DNA methylation assays of the crab-eating macaque.
2020-09-15 | GSE154078 | GEO
Project description:Illumina Infinium HumanMethylation850 BeadChip (also known as Illumina EPIC array, GPL23976) was used to generate DNA methylation data from synthetic DNA from 3 species. The DNA samples from each species were enzymatically manipulated so that they would exhibit 0%, 25%, 50%, 75% and 100% percent methylation at each CpG location, respectively. The variable “ProportionMethylated” (with ordinal values 0, 0.25, 0.5, 0.75, 1) can be interpreted as a benchmark for each CpG that maps to the respective genome. Thus, the DNA methylation levels of each CpG are expected to have a high positive correlation with ProportionMethylated across the arrays measurement for the human species. The human EPIC array was applied to calibration data from mouse (n=15 EPIC arrays, 3 per methylation level) and rat (n=10, 2 per methylation level). The EPIC array data were normalized using the noob method (R function preprocessNoob in minfi).
2021-08-27 | GSE174568 | GEO
Project description:Spatial transcriptomics is a rapidly advancing field, yet it lacks standardized metrics for evaluating imaging-based in situ hybridization technologies. In this study, we emphasize the importance of rigorous experimental design and standardized operating procedures (SOPs) in defining performance metrics across multiple modalities—from single-cell to spatial transcriptomics to spatial proteomics. Our Spatial Touchstone (ST) dataset, generated from six tissue types across three global sites (n=76 assays), provides a comprehensive evaluation of reproducibility, sensitivity, dynamic ranges, signal-to-noise ratio, false discovery rates, cell type annotation, and congruence with single-cell profiling. Using single-nucleus RNA sequencing (snRNA-seq) on the same formalin-fixed paraffin-embedded tissues, we created a reference for transcriptional profiles to assess cellular organization and biomarker localization. In the absence of an independent 'gold standard’ in the field, this study provides an objective assessment of technical performance through standardized protocols, Spatial Touchstone Protocols (STSOP). Our open-source software, SpatialQC, allows users to evaluate samples across all technical metrics and directly impute cell annotations from single-cell datasets. This study features the largest imaging-based spatial transcriptomics data repository available, with a total of 203 spatial profiles. It incorporates both public (n=127) and ST datasets (n=76) through the Spatial Touchstone Portal (STP), available at www.spatialtouchstone.org. This resource offers users easy access to analyze and compare their own data against an extensive collection of imaging-based datasets. We show that the ST datasets demonstrate high reproducibility (r=0.93 to 1.0) and set a new benchmark for the field. Finally, we establish metrics to evaluate and integrate imaging based multi omics data from single cell into spatial transcriptomics to spatial proteomics. The ST project provides a comprehensive, reproducible assessment across platforms and sites, establishing essential standards for imaging-based spatial multi omics (transcriptomics and proteomics) and paving the way for future research and technological advancements.
2025-07-28 | GSE277080 | GEO
Project description:This submission includes the complete set of raw data generated from the analytical standard, the concept of which is described in our manuscript "Proteome-Scale Recombinant Standards And A Robust High-Speed Search Engine To Advance Cross-Linking MS-Based Interactomics". In this study, we develop a strategy to generate a well-controlled XL-MS standard by systematically mixing and cross-linking recombinant proteins. The standard can be split into independent datasets, each of which has the MS2-level complexity of a typical proteome-wide XL-MS experiment. This submission includes 5 raw datasets (batches 1-5), each comprising 64 randomly selected human proteins engaging in up to 224 allowed protein-protein interactions per dataset. The data were searched with Scout (v. 1.4.14, https://github.com/diogobor/Scout) and results are reported in mzIdentML 1.2.0 format. For the specific results reported in our original publication, please refer to PXD042173.
2024-08-06 | PXD042173 | Pride
Project description:Three-dimensional imaging mass spectrometry (3D imaging MS) is a technique of analytical chemistry for 3D molecular analysis of a tissue specimen, entire organ, or microbial colonies on an agar plate. 3D imaging MS has unique advantages over existing 3D imaging techniques, offers novel perspectives for understanding the spatial organization of biological processes, and has growing potential to be introduced into routine use in both biology and medicine. Due to the sheer quantity of data generated, visualization, analysis, and interpretation of 3D imaging MS data remain a significant challenge. Bioinformatics research in this field is hampered by the lack of publicly available benchmark datasets needed for evaluation and comparison of algorithms. Findings We acquired high-quality 3D imaging MS datasets from different biological systems at several labs, supplied them with overview images and scripts demonstrating how to read them, and deposited them into MetaboLights, an open repository for metabolomics data. 3D imaging MS data was collected from five samples using two types of 3D imaging MS. 3D Matrix-Assisted Laser Desorption/Ionization (MALDI) imaging MS data was collected from murine pancreas, murine kidney, human oral squamous cell carcinoma, and interacting microbial colonies cultured in Petri dishes. 3D Desorption Electrospray Ionization (DESI) imaging MS data was collected from a human colorectal adenocarcinoma. Conclusions With the aim to stimulate computational research in the field of computational 3D imaging MS, we provided selected high-quality 3D imaging MS datasets which can be used by algorithm developers as benchmark datasets.
2016-07-27 | MTBLS176 | MetaboLights
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.
2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress
Project description:Cohort: Raw genotype files for GEN_COVID cohort. Genotype Chip: Illumina Global Screening Array-24 v3.0 + Multi-Disease beadchip genomic build: b37
| EGAD00010002177 | EGA
Project description:Cohort: Raw genotype files for BelCovid2 cohort. Genotype Chip: Illumina Global Screening Array-24 v3.0 + Multi-Disease beadchip genomic build: b37
| EGAD00010002179 | EGA
Project description:This repository is related to the work "Benchmarking commonly usedsoftware suites and analysis workflows for DIA proteomics and phosphoproteomics". The following files are stored here: 1. four MS datasets generated in this work, including two two-species benchmark datasets acquired on QE HF and timsTOF Pro, and two TNF-alpha induced phosphoproteomics datasets acquired on QE HF-X and timsTOF Pro; 2. all spectral libraries used in this work; 3. raw MS data search reports with analysis logs included if software reported; 4. preprocessed MS data search reports for any result from HF and TIMS DIA benchmark datasets; 5. FASTAs used in this work; 6. a description file (Description_of_iProX_and_public_data.xlsx) for the stored files in this repository and other public data used in this work. Note: 3 and 4 are packed into one zip file for each data search experiment.
2022-12-08 | PXD034709 |
Project description:The presented approach is a combination of analytical flow rate chromatography with ion mobility separation of peptide ions, data-independent acquisition, and raw data processing using the DIA-NN software suite, to conduct fast, low-cost proteomic experiments that only require moderate sample amounts. The present dataset contains a series of benchmarks. Specifically, a dilution series of a K562 digest standard acquired using 5-minute and 3-minute chromatographic gradients, as well as a mixed-species human–E.coli benchmark for quantitative performance. We further demonstrate the application of the proposed approach to the analysis of plasma proteomes of COVID-19 patients, using a 3-minute gradient acquisition on a dual-column liquid chromatography system at a throughput of 398 samples/day.
2023-07-03 | PXD040205 | Pride