Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Selection of RNA aptamers against human islets by SELEX and toggle SELEX

ABSTRACT: Selection of RNA aptamers against human islets by SELEX and toggle SELEX

PROVIDER: PRJNA809588 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR18110617.fastq.gz	Fastqsanger.gz
	SRR18110618.fastq.gz	Fastqsanger.gz
	SRR18110619.fastq.gz	Fastqsanger.gz
	SRR18110620.fastq.gz	Fastqsanger.gz
	SRR18110621.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 12

Similar Datasets

Selection of RNA aptamers against human islets by SELEX and toggle SELEX

Project description:Type 1 Diabetes is still an incurable disease characterized by autoimmune destruction of insulin-producing beta cells within the islet of Langerhans in the pancreas. Currently, there are no methods to monitor beta-cell mass in humans or deliver therapeutics specifically to beta cells. Here we performed Cluster Systematic Evolution of Ligands by Exponential Enrichment (SELEX) experiments and toggle SELEX experiments to identify RNA aptamers specific for human islets. In the cluster SELEX, we started from a random library of RNA nucleotides composed of a 40 nucleotide long variable region flanked by two constant regions. We performed eight selection cycles using hand-picked islets and islet-depleted acinar tissue from 4 cadaveric human donors as positive and negative selectors. In the toggle SELEX, we conducted eight cycles of selection using islets and acinar tissue from mice, followed by two cycles of selection using human tissues. The polyclonal libraries from the two selection strategies showed a convergent evolution of ligands and increased specificity for human islets.

2022-02-23 | GSE197262 | GEO

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.

2019-12-31 | GSE137006 | GEO

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

| PRJNA564266 | ENA

Blocker-SELEX: A Structure-Guided Strategy for Developing Inhibitory Aptamers Disrupting Transcription Factor Interactions

Project description:Despite the well-established significance of transcription factors (TFs) in pathogenesis, their utilization as pharmacological targets has been limited by the inherent challenges mainly associated with modulating their protein-protein and protein-DNA interactions. The lack of defined small-molecule binding pockets and the nuclear localization of TFs makes neither small molecule inhibitors nor neutral antibodies suitable in blocking TF interactions. Aptamers are short oligonucleotides exhibiting high affinity and specificity for a diverse range of targets. The large molecular weights, expansive blocking surfaces and efficient cellular internalization make aptamers as a compelling molecular tool for traditional TF interaction modulators. Here, we report a structure-guided design strategy called Blocker-SELEX for developing inhibitory aptamers (iAptamer) that selectively block TF interactions. Our approach led to the discovery of an iAptamer that cooperatively disrupts SCAF4/SCAF8-RNA Polymerase II (RNAP2) interactions, thus dysregulates RNAP2 dependent gene expression and splicing, leading to the impairing of cell proliferation. This approach was further applied to develop iAptamers efficiently block WDR5-MYC interaction. Together, our study highlights the potential of Blocker-SELEX in developing iAptamers that effectively disrupt TF interactions, and the generated iAptamers hold promising implications as chemical tools in studying biological functions of TF interactions and the potential for nucleic acids drug development.

2024-02-01 | GSE254651 | GEO

Identify aptamers binding human PD-L1 protein by SELEX

Project description:Identify aptamers binding human PD-L1 protein by SELEX

| PRJEB65891 | ENA

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

| PRJNA514043 | ENA

Blocker-SELEX: A Structure-Guided Strategy for Developing Inhibitory Aptamers Disrupting Transcription Factor Interactions

Project description:Blocker-SELEX: A Structure-Guided Strategy for Developing Inhibitory Aptamers Disrupting Transcription Factor Interactions

| PRJNA1071201 | ENA

DNA aptamers that modulate biological activity of model neurons

Project description:There is an urgent need for agents that promote health and regeneration of cells and tissues, specifically to treat diseases of the aging nervous system. Age-associated nervous system degeneration and various diseases are driven by many different biochemical stresses, often making it difficult to target any one disease cause. Our laboratory has previously identified DNA aptamers with apparent regenerative properties in murine models of multiple sclerosis by selecting aptamers that bind oligodendrocyte membrane preparations. Here, we selected from vast libraries of molecules (~1014 unique DNAs) those with the ability to bind cultured human SH-SY5Y neuroblastoma cells as a neuronal model, followed by screening for aptamers capable of eliciting biological responses, with validation of binding in differentiated SH-SY5Y, human iPSC-derived sensory neurons, and hESC derived cortical neurons. This demonstrates a proof-of-concept workflow to identify biologically active aptamers by cycles of cell selection.

2024-11-11 | GSE278187 | GEO

Natural RNA polymerase aptamers regulate transcription in E. coli [SELEX]

Project description:In search for RNA signals that modulate transcription via direct interaction with RNA polymerase (RNAP) we deep-sequenced an E. coli genomic library enriched for RNAP-binding RNAs. Many natural RNAP-binding aptamers, termed RAPs, were mapped to the genome. Over 60% of E. coli genes carry RAPs in their mRNA. Combining in vitro and in vivo approaches we characterized a subset of RAPs (iRAPs) that promote Rho-dependent transcription termination. A representative iRAP within the coding region of the essential gene, nadD, greatly reduces its transcriptional output in stationary phase and under oxidative stress, demonstrating that iRAPs control gene expression in response to changing growth conditions. The mechanism of iRAPs involves active uncoupling of transcription and translation, making the nascent RNA accessible to Rho. iRAPs encoded in the antisense strand also promote gene expression by reducing transcriptional interference. In essence, our work uncovers a broad class of cis-acting RNA signals that globally control bacterial transcription.

2017-06-01 | GSE98659 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data