Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Bottom 16S rRNA amplicon sequencing of the northern Adriatic Sea

PROVIDER: PRJNA818144 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR18394658_1.fastq.gz	Fastqsanger.gz
	SRR18394658_2.fastq.gz	Fastqsanger.gz
	SRR18394659_1.fastq.gz	Fastqsanger.gz
	SRR18394659_2.fastq.gz	Fastqsanger.gz
	SRR18394660_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 78

Similar Datasets

Project description:Surface 16S rRNA amplicon sequencing of the northern Adriatic Sea

| PRJNA818117 | ENA

Project description:ITS amplicon sequencing, northern Adriatic Sea

| PRJNA1061483 | ENA

Algal microbiome

Project description:Algae-associated microbiome 16S rRNA amplicon sequencing from Northern Adriatic Sea (Gulf of Trieste)

| PRJEB60814 | ENA

Project description:DNA metabarcoding (16S rRNA) of the northern Adriatic Sea

| PRJNA767222 | ENA

Soil Metaproteomics LC-MS

Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.

2022-03-01 | PXD009773 | Pride

Quantification of mock microbial communities with metagenomes, 16S rRNA gene amplicons and metaproteomics

Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.

2017-05-12 | PXD006118 | Pride

Diversity of free-living and particle-attached prokaryotes in a river-influenced coastal area of the Northern Adriatic Sea

Project description:Prokaryotic communities in the Northern Adriatic Sea

| PRJEB52252 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Time course study of Mediterranean mussel (M. galloprovincialis, Lmk, 1819) digestive gland treated with okadaic acid

Project description:Mytilus galloprovincialis (Lmk, 1819) is economically relevant bivalve specie. In Adriatic Sea, periodical temperatures increases define optimal growth conditions for Dinoflagellate spp which can reach high concentrations also in filter-feeding mussels, thus causing potential human health problems. The most commonly used methods for the detection of Diarrhoeic Shellfish Poisoning biotoxins have either a low sensitivity or are too expensive to be used for routine tests. Genomic tools, such as microarray platforms, provide a reliable and alternative solution to overcome these problems. In this study we used a mussel cDNA microarray for studying gene expression changes in mussels exposed to Okadaic acid. Mussels collected in the Gulf of Trieste, located in Northern Adriatic Sea, were fed with Okadaic acid-spiked invertebrates for five weeks. In a time course experiment we were able to describe an early acute response just from the first 4th day time point. Among the differentially expressed genes we found a general up-regulation of stress proteins and proteins involved in cellular synthesis. Overall, we identified 34 transcripts candidate as useful markers to monitor OA-induced stress in mussels. This study contributes to the characterization of many potential genetic markers that could be used in future environmental monitoring, and could lead to explore new mechanisms of stress tolerance in marine mollusc species. Keywords: Time course, stress response

2009-02-19 | GSE14885 | GEO

Study of Gut Microbiome and Colorectal Tumors

Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.

| 2255499 | ecrin-mdr-crc

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data