Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptome analysis of tumors from genetically engineered mouse models carrying Cbfb and/or Pik3ca mutations

ABSTRACT: Transcriptome analysis of tumors from genetically engineered mouse models carrying Cbfb and/or Pik3ca mutations

PROVIDER: PRJNA851443 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR19772129_1.fastq.gz	Fastqsanger.gz
	SRR19772129_2.fastq.gz	Fastqsanger.gz
	SRR19772130_1.fastq.gz	Fastqsanger.gz
	SRR19772130_2.fastq.gz	Fastqsanger.gz
	SRR19772131_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 36

Similar Datasets

Transcriptome analysis of tumors from genetically engineered mouse models carrying Cbfb and/or Pik3ca mutations

Project description:Tumors harvested from mice carrying positive MMTV-Cre transgene, homozygously or heterozygously deleted or wild type Cbfb allele, and heterozygous Pik3ca transgene were subject to RNA extraction. Extracted RNA with a RIN larger than 7 was subject to RNAseq. to generate the mice, breeder pairs of Gt(ROSA)26Sortm1(Pik3ca*H1047R)Egan/J (Stock No: 016977), Cbfbtm2.1Ddg/J (Stock No: 028550), and Tg(MMTV-Cre)4Mam/J (Stock No: 003553) strains were purchased from Jackson Laboratory. MMTV-Cre mice lines were genotyped using real time PCR [forward primer (FP): 5’-CCGGTTATTCAACTTGCACC-3' and reverse primer (RP) 5’-CTGCATTACCGGTCGATGCAAC- 3']. CBFB deletion was confirmed using real-time PCR with primers: FP: 5’-GCGCGCCAGTCACTTGTT-3' and RP: 5'- ATCCCACGAACCGAACCA-3'. Pik3ca mice were genotyped using primers; FP: 5'- AAAGTCGCTCTGAGTTGTTAT-3', RP1: 5'- GCGAAGAGTTTGTCCTCAACC -3' for mutant Pik3ca and RP2: 5'- GGAGCGGGAGAAATGGATATG -3' for wild type Pik3ca.

2024-10-22 | GSE206598 | GEO

RNA-seq of genetically engineered mouse microglia

Project description:RNA-seq of genetically engineered mouse microglia

| PRJNA803528 | ENA

RNA-seq of genetically engineered mouse microglia

Project description:RNA-seq of genetically engineered mouse microglia sorted into populations.

2022-04-06 | GSE196174 | GEO

Francisella tularensis subsp. tularensis strain:genetically engineered

Project description:Francisella tularensis subsp. tularensis strain:genetically engineered Genome sequencing

| PRJNA1040318 | ENA

A genetically engineered mouse model of NUT carcinoma

Project description:A genetically engineered mouse model of NUT carcinoma

| PRJNA1008241 | ENA

RNAseq of genetically engineered mouse model (GEMM) tumors

Project description:We report the expression profiling of lung adenocarcinoma tumors arising from genetically engineered mice with activation of KRAS(K) and loss of either SMARCA4 (S), p53(P) or both.

2018-06-17 | GSE94927 | GEO

Cbfb/Runx1-repression independent blockage of differentiation and accumulation of Csf2rb expressing cells by Cbfb-MYH11

Project description:It is known that CBFB-MYH11, the fusion gene generated by inversion of chromosome 16 in human acute myeloid leukemia, is causative for oncogenic transformation. However, the mechanism by which CBFB-MYH11 initiates leukemogenesis is not clear. Previously published reports showed that CBFB-MYH11 dominantly inhibits RUNX1 and CBFB, and such inhibition has been suggested as the mechanism for leukemogenesis. However, knockin mice expressing Cbfb-MYH11 (Cbfb+/MYH11) showed defects in primitive hematopoiesis not seen in Cbfb null (Cbfb-/-) embryos indicating that Cbfb-MYH11 has repression independent activities as well. To identify gene expression changes associated with this novel activity, we compared the gene expression profile in the blood cells of Cbfb+/MYH11 and Cbfb-/- embryonic day 12.5 (E12.5) embryos with that of their wildtype littermates. Cbfb-MYH11 chimeras were mated to C57/Bl6 females to generate Cbfb+/MYH11 (Cbfb+/MYH11) and Cbfb+/+ (WT) embryos. Cbfb+/- x Cbfb+/- matings were used to generate Cbfb+/+ (Cbfb+/+) and Cbfb-/- (Cbfb-/-) embryos. Blood from 8-10 E12.5 embryos of the same genotype was pooled, and RNA was isolated, labeled, and hybridized to Affymetrix Genechip mouse microarray (430 2.0) chips. 4 chips were used for both the Cbfb+/MYH11 and littermate control samples. 3 chips were used for the Cbfb-/- samples and littermate control samples.

2010-04-12 | E-GEOD-19194 | biostudies-arrayexpress

Cbfb/Runx1-repression independent blockage of differentiation and accumulation of Csf2rb expressing cells by Cbfb-MYH11

2010-03-31 | GSE19194 | GEO

mTORC1-driven protein translation correlates with clinical benefit of capivasertib within a genetically preselected cohort of PIK3CA-altered tumours

Project description:Capivasertib is a potent selective inhibitor of AKT. It was recently FDA-approved in combination with fulvestrant to treat HR+, HER2-negative breast cancers with certain genetic alteration(s) activating the PI3K pathway. In Phase I trials, heavily pre-treated patients with tumours selected for activating PI3K pathway mutations treated with capivasertib monotherapy demonstrated objective response rates of <30%. We investigated the proteomic profile associated with capivasertib response in genetically pre-selected patients and cancer cell lines. We analyzed samples from 16 PIK3CA-mutated patient tumours collected prior to capivasertib monotherapy in the Phase I trial. PI3K pathway proteins were precisely quantified with immuno-MALDI-MS. Global proteomic profiles were also obtained. Patients were classified according to response to capivasertib monotherapy: “clinical benefit (CB)” (≥12 weeks without progression, n=7) or “no clinical benefit (NCB)” (progression in <12 weeks, n=9). Proteins that differed between the patient groups were subsequently quantified in AKT1- or PIK3CA-altered breast cancer cell lines with varying capivasertib sensitivity. The measured concentrations of AKT1 and AKT2 varied among the PIK3CA-mutated tumours but did not differ between the CB and NCB groups. However, analysis of the global proteome data showed that translational activity was higher in tumours of the NCB vs. CB group. When reproducibly quantified by validated LC-MRM-MS assays, the same proteins of interest similarly distinguished between capivasertib-sensitive vs. -resistant cell lines. The results provide further evidence that increased mTORC1-driven translation functions as a mechanism of resistance to capivasertib monotherapy. Protein concentrations may offer additional insights for patient selection for capivasertib, even among genetically pre-selected patients.

2024-10-17 | PXD052949 | Pride

Genetically engineered endothelial niche induces vascularization in human kidney organoids

Project description:Here we developed a method to incorporate a genetically engineered endothelial niche into an established protocol for generating human kidney organoids.

2023-05-22 | GSE232767 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data