Small RNA sequencing analysis of peptide-affinity isolated plasma extracellular vesicles distinguishes pancreatic cancer patients from non-affected individuals
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA913165 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR22777518.fastq.gz | Fastqsanger.gz | |||
| SRR22777519.fastq.gz | Fastqsanger.gz | |||
| SRR22777520.fastq.gz | Fastqsanger.gz | |||
| SRR22777521.fastq.gz | Fastqsanger.gz | |||
| SRR22777522.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 29 |
Similar Datasets
Project description:Pancreatic ductal adenocarcinoma (PDAC) has a high fatality rate, mainly due to its asymptomatic nature until late-stage disease and therefore delayed diagnosis that leads to a lack of timely treatment intervention. Consequently, there is a significant need for better methods to screen populations that are at high risk of developing PDAC. Such advances would result in earlier diagnosis, more treatment options, and ultimately better outcomes for patients. Several recent studies have applied the concept of liquid biopsy, which is the sampling of a biofluid (such as blood plasma) for the presence of disease biomarkers, to develop screening approaches for PDAC; several of these studies have focused on analysis of extracellular vesicles (EVs) and their cargoes. While these studies have identified many potential biomarkers for PDAC that are present within EVs, their application to clinical practice is hindered by the lack of a robust, reproducible method for EV isolation and analysis that is amenable to a clinical setting. Our previous research has shown that the Vn96 synthetic peptide is indeed a robust and reproducible method for EV isolation that has the potential to be used in a clinical setting. We have therefore chosen to investigate the utility of the Vn96 synthetic peptide for this isolation of EVs from human plasma and the subsequent detection of small RNA biomarkers of PDAC by Next-generation sequencing (NGS) analysis. We find that analysis of small RNA from Vn96-isolated EVs permits the robust discrimination of PDAC patients from non-affected individuals. Moreover, analyses of all small RNA species, miRNAs, and lncRNAs are most effective at segregating PDAC patients from non-affected individuals. We further identified 34 chromosomal regions that encode small RNAs whose differential expression in Vn96-isolated EVs strongly distinguishes PDAC patients from non-affected individuals. Several of the identified small RNA biomarkers have been previously associated with and/or characterized in PDAC, indicating the validity of our findings, whereas other identified small RNA biomarkers may have novel roles in PDAC or cancer in general. Overall, our results provide a basis for a clinically-amendable detection and/or screening strategy for PDAC using a liquid biopsy approach that relies on Vn96-mediated isolation of EVs from plasma.
2023-06-08 | GSE221185 | GEO
Project description:Pancreatic ductal adenocarcinoma (PDAC) has a high fatality rate, mainly due to its asymptomatic nature until late-stage disease and therefore delayed diagnosis that leads to a lack of timely treatment intervention. Consequently, there is a significant need for better methods to screen populations that are at high risk of developing PDAC. Such advances would result in earlier diagnosis, more treatment options, and ultimately better outcomes for patients. Several recent studies have applied the concept of liquid biopsy, which is the sampling of a biofluid (such as blood plasma) for the presence of disease biomarkers, to develop screening approaches for PDAC; several of these studies have focused on analysis of extracellular vesicles (EVs) and their cargoes. While these studies have identified many potential biomarkers for PDAC that are present within EVs, their application to clinical practice is hindered by the lack of a robust, reproducible method for EV isolation and analysis that is amenable to a clinical setting. Our previous research has shown that the Vn96 synthetic peptide is indeed a robust and reproducible method for EV isolation that has the potential to be used in a clinical setting. We have therefore chosen to investigate the utility of the Vn96 synthetic peptide for this isolation of EVs from human plasma and the subsequent detection of small RNA biomarkers of PDAC by Next-generation sequencing (NGS) analysis. We find that analysis of small RNA from Vn96-isolated EVs permits the discrimination of PDAC patients from non-affected individuals. Moreover, analyses of all small RNA species, miRNAs, and lncRNA fragments are most effective at segregating PDAC patients from non-affected individuals. Several of the identified small RNA biomarkers have been previously associated with and/or characterized in PDAC, indicating the validity of our findings, whereas other identified small RNA biomarkers may have novel roles in PDAC or cancer in general. Overall, our results provide a basis for a clinically-amendable detection and/or screening strategy for PDAC using a liquid biopsy approach that relies on Vn96-mediated isolation of EVs from plasma.
| S-EPMC10247738 | biostudies-literature
Project description:During microRNA (miRNA)-guided gene silencing, Argonaute (Ago) proteins interact with a member of the TNRC6/GW protein family. Here we used a short GW protein-derived peptide fused to GST and demonstrate that it binds to Ago proteins with high affinity. This allows for the simultaneous isolation of all Ago protein complexes expressed in diverse species to identify associated proteins, small RNAs or target mRNAs. We refer to our method as Ago protein Affinity Purification by Peptides (Ago-APP). Comparison of small RNA lengths in total RNA and APP-enriched RNA samples
2015-09-08 | E-GEOD-70553 | biostudies-arrayexpress
Project description:Background: Exosomes and extracellular vesicles (EVs) are increasingly recognized as important sources of biomarkers for disease study and diagnosis. Results: A synthetic peptide, Vn96, allows for capture of EVs from biological fluids using basic laboratory equipment. Conclusion: The Vn96-captured EVs are qualitatively equivalent or superior to exosomes isolated by ultracentrifugation. Significance: The Vn96 peptide provides an effective affinity-capture method for the isolation of EVs from biological fluids.
2014-06-14 | GSE58464 | GEO
Project description:Background: Exosomes and extracellular vesicles (EVs) are increasingly recognized as important sources of biomarkers for disease study and diagnosis. Results: A synthetic peptide, Vn96, allows for capture of EVs from biological fluids using basic laboratory equipment. Conclusion: The Vn96-captured EVs are qualitatively equivalent or superior to exosomes isolated by ultracentrifugation. Significance: The Vn96 peptide provides an effective affinity-capture method for the isolation of EVs from biological fluids. In order to compare different methods of exosome purification, we compared RNA content of exosomes purified with each method. We used two different breast cancer cell lines MCF7 and MDA-MB-231. We processed data in order to identify large RNAs as well as small RNA by using different methods for the alignment
2014-06-14 | E-GEOD-58464 | biostudies-arrayexpress
Project description:During microRNA (miRNA)-guided gene silencing, Argonaute (Ago) proteins interact with a member of the TNRC6/GW protein family. Here we used a short GW protein-derived peptide fused to GST and demonstrate that it binds to Ago proteins with high affinity. This allows for the simultaneous isolation of all Ago protein complexes expressed in diverse species to identify associated proteins, small RNAs or target mRNAs. We refer to our method as Ago protein Affinity Purification by Peptides (Ago-APP).
2015-09-08 | GSE70553 | GEO
Project description:Activation of CD8+ T cells depends exquisitely on the affinity of the T cell receptor (TCR) for a peptide MHC (pMHC) ligand complex. Here, we activated OT-I transgenic CD8+ T cells with pure peptide and examined early activation responses by single-cell RNA-sequencing. T cells were activated with the high affinity OT-I cognate peptide (N4=SIINFEKL) for 1, 3 or 6 hours, or with reduced affinity peptides (T4=SIITFEKL and G4=SIIGFEKL) or the non-binding peptide (NP68=ASNENMDAM) for 6 hours. Cells were then sorted into 96-well plates by FACS and RNA was sequenced following an adapted Smart-Seq2 protocol.
2018-06-25 | E-MTAB-6051 | biostudies-arrayexpress
Project description:To identify RNAs specifically associated with potential RBPs, yeast cells expressing TAP-tagged RBP or the wild-type strain BY4741 (mock control) were grown to mid-log phase in rich medium and harvested by centrifugation. RNA affinity isolations were essentially performed as described (Gerber et al. 2004 PLoS Biol.; see protocol). In brief, TAP-tagged protein were captured from cell extracts with IgG coupled agarose beads (Sigma) and released by incubation with a site-specific protease (AcTEV, Sigma). from the extract (input) and from the affinity isolates was purified with the RNeasy Mini/ Micro Kit (Qiagen). RNAs were reverse transcribed using a mixture of oligo-dT and random nonamer oligos in the presence of amino-allyl dUTP/dNTP mixture. cDNAs were fluorescently labeled and hybridized on yeast oligo microarrays over night at 42 degrees in formamide-based hybridization buffer. Antigenic peptide used in IP: TAP-tag An all pairs experiment design type is where all labeled extracts are compared to every other labeled extract.
2010-12-06 | E-GEOD-21864 | biostudies-arrayexpress
Project description:TCR Rep-Seq of COVID-19 affected individuals
| PRJEB70840 | ENA
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
2019-09-30 | GSE124865 | GEO