Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Different protocrom stages of Gymnadenia conopsea

ABSTRACT: 16S rDNA sequence of different protocrom stages of Gymnadenia conopsea Raw sequence reads

PROVIDER: PRJNA976517 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR25212500_subreads.fastq.gz	Fastqsanger.gz
	SRR25212501_subreads.fastq.gz	Fastqsanger.gz
	SRR25212502_subreads.fastq.gz	Fastqsanger.gz
	SRR25212503_subreads.fastq.gz	Fastqsanger.gz
	SRR25212504_subreads.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 50

Similar Datasets

16S rRNA metabarcoding data from Ips typographus beetles at 4 different life stages

Project description:16S rRNA metabarcoding data from Ips typographus beetles at 4 different life stages Raw sequence reads

| PRJNA888454 | ENA

Project description:raw sequences of endophytic bacteria of Gymnadenia conopsea

| PRJNA699690 | ENA

Project description:Studies of root-associated microbiomes in Gymnadenia conopsea

| PRJNA598558 | ENA

Schistosoma mansoni transcriptomics at different life stages

Project description:Schistosoma mansoni transcriptomics at different life stages

| PRJEB2350 | ENA

Transcriptome sequence of oriental melon fruit at diferent stages in two cultivars

Project description:Purpose: the goals of this study are to compare fruit of two clitivars oriental melon transcriptome profiling (RNA-seq) at different stages to explore carotenoid potentail carotenoid accumulation mechanism Methods:The transcriptome sequence of two cultivars oriental melon fruits at different stages were generated by deep sequencing with three repeats using Illumina. The sequence reads that passed filters were mapped to melon genome (http://cucurbitgenomics.org/organism/18) using HISAT2 software. The differently expressed genes were identify by |log2(FoldChange)| > 0 & padj <= 0.05, and qRT–PCR validation was performed using SYBR Green assays Result:Using an optimized data analysis workflow, we mapped about 40 million sequence reads per sample to the melon genome. The differentially expressed genes were functionally classified by GO and KEGG enrichment. We focused on carotenoid metabolism related gene and validated using qRT-PCR. The results showed RNA-seq and qRT-PCR were highly correlated. Conclusion: Our study provided transcriptome sequence of oriental melon fruits at different stages in two cultivars. The optimized data analysis workflows reported here should provide comparative framework of expression profiles. Our transcriptome characterization contribute to analyze gene functions and metabolic process of oriental melon.

2022-01-13 | GSE193412 | GEO

Project description:The raw sequence of endophytes and soil fungi of Gymnadenia conopsea

| PRJNA699676 | ENA

Transcriptome analysis in D. discoideium (AX2) in different developmental stages

Project description:The goal of RNA-seq is to identify the differential expressed genes in the wild-type D.discoideum at different developmental stages (vegetative, streaming, mound and fruiting bodyies). Two biological replicates were assigned for each group and in total 8 groups were prepared for RNA-seq libraries with 500 ng mRNA as starting materials using NEXTflex Illumina qRNA-Seq Library Prep Kit (Bioo Scientific). We mapped about 20 - 30 million reads per sample to D. discoideum with bowtie2 workflow. The analysis pipeline started with pseudo-alignment of the reads using kallisto, followed by building an index and quantification process, which generated h5 files containing the raw binary files for preliminary differential analysis in sleuth. Differential analysis were conducted in EdgeR. The significant genes were deducted by computing NB exact genewise tests with corrected p < 0.05. Our results showed stage-specific gene expression profiles in different developmental stages.

2021-04-21 | GSE137602 | GEO

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Project description:Studies of root-associated bacterial microbiomes in Gymnadenia conopsea

| PRJNA598739 | ENA

Next Generation Sequencing Facilitates Quantitative Analysis of the transcriptome of different developmental stages and tissues in Ostrinia furnacalis

Project description:The goals of this study are to obtain the transcriptome profiling (RNA-seq) of different developmental stages and tissues in Ostrinia furnacalis. Methods: O. furnacalis embryos were collected less than 12 h post oviposition. 1st, 3rd and 5th instar of the Asian corn borer, which represents the newly hatched larvae, the middle stage of larvae and the mature larvae, was harvested for subsequent experiments. Pupae and adults were grouped into females and males, then female and male samples were mixed at the ratio of 1:1. The 3rd instar larvae were anesthetized on an ice plate for tissue extraction. The midgut, fat body and silk gland were isolated. All these samples were generated by deep sequencing, in triplicate, using Illumina NovaSeq 6000. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows–Wheeler Aligner (BWA) followed by ANOVA (ANOVA) and TopHat followed by Cufflinks. Results: We obtained the transcriptome profiling (RNA-seq) of different developmental stages and tissues in Ostrinia furnacalis Conclusions: Our study representsa detailed analysis of different developmental stages and tissues in Ostrinia furnacalis

2022-03-04 | GSE197663 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data