Ontology highlight
ABSTRACT:
PROVIDER: PRJNA977205 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR24757300.fastq.gz | Fastqsanger.gz | |||
| SRR24757301.fastq.gz | Fastqsanger.gz | |||
| SRR24757302.fastq.gz | Fastqsanger.gz | |||
| SRR24757303.fastq.gz | Fastqsanger.gz | |||
| SRR24757304.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 54 |
Similar Datasets
Project description:We sought to characterise how chromatin states affected CRISPR/Cas9 activity and the induced indel profiles. We used two different doses of Trichostatin and two different doses of a EZH2 inhibitor to modulate the chromatin state and then performed targeted DNA-seq of selected sgRNA target regions to identify the indels.
2018-12-13 | E-MTAB-7091 | biostudies-arrayexpress
Project description:We performed a large-scale genome-wide characterisation of indels generated following editing with CRISPR/Cas9. We used pools of sgRNAs and performed targeted capture and sequencing of the edited regions in HepG2 cells.
2018-12-13 | E-MTAB-7095 | biostudies-arrayexpress
Project description:CRISPRs and TALENs are efficient systems for gene editing in many organisms including plants. In many cases the CRISPR-Cas or TALEN modules are expressed in the plant cell only transiently. Theoretically, transient expression of the editing modules should limit unexpected effects compared to stable transformation. However, very few studies have measured the off-target and unpredicted effects of editing strategies on the plant genome, and none of them have compared these two major editing systems. We conducted a comprehensive genome-wide investigation of off-target mutations using either a CRISPR-Cas9 or a TALEN strategy. We observed a similar number of SNVs and InDels for the two editing strategies compared to control non-transfected plants, with an average of 8.25 SNVs and 19.5 InDels for the CRISPR-edited plants, and an average of 17.5 SNVs and 32 InDels for the TALEN-edited plants. Interestingly, a comparable number of SNVs and InDels could be detected in the PEG-treated control plants. This shows that except for the on-target modifications, the gene editing tools used in this study did not show a significant off-target activity nor unpredicted effects on the genome, and that the PEG treatment in itself was probably the main source of mutations found in the edited plants.
2022-03-03 | E-MTAB-11497 | biostudies-arrayexpress
Project description:C-to-T base editing mediated by CRISPR/Cas9 base editors (BEs) needs a G/C-rich PAM and the editing fidelity is compromised by unwanted indels and non-C-to-T substitutions. We developed CRISPR/Cpf1-based BEs to recognize a T-rich PAM and induce efficient C-to-T editing with few indels and/or non-C-to-T substitutions. The requirement of editing fidelity in therapeutic-related trials necessitates the development of CRISPR/Cpf1-based BEs, which also facilitates base editing in A/T-rich regions.
2018-10-16 | GSE105002 | GEO
Project description:Milk fat globule EGF factor 8 (MFGE8) is a glycoprotein which plays a crucial role in mammary gland remodeling. Our group previously identified MFGE8 as a marker associated with high milk yielding cows. Here, we generated MFGE8 knock-out buffalo mammary epithelial cells (BuMEC) via CRISPR-cas9 technology to decipher its role in lactation. gRNA3 reduced MFGE8 expression with good efficiency which was confirmed at transcriptomic and proteomic level and the stable knock-out cells obtained were named mfge8-/-/gRNA3. The amplicon sequencing of the edited region using next generation sequencing (NGS) showed that 54% of total reads showed indels, 3-4 bp upstream to PAM site in 2nd exon. A total 4282 proteins were identified when proteome level changes were examined and 178 were found to be differentially expressed above and below a threshold of ≥1.5 and ≤0.6. Major DEPs were found to be associated with regulation of hydrolase activity, endopeptidase activity and cytoskeletal organization and some DEPs including FABP3, FABP4, FABP5, KNG1, MT2A, CD82 and SERPINH1 belonged to genes associated with milk synthesis. To the best of our knowledge, this is the first study which provides a comprehensive proteome profile of MFGE8 knockout BuMEC and explores downstream effects of disruption of MFGE8 gene.
2025-08-25 | PXD048149 | Pride
Project description:Continued CRISPR/Cas9-mediated editing activity that allows differential and asynchronous modification of alleles in successive cell generations expands allelic complexity. To understand the earliest events during CRISPR/Cas9 editing and the allelic selection among the progeny of subsequent cell divisions, we inspected in detail the genotypes of 4- and 8-cell embryos and embryonic stem cells (ESCs) after microinjection of a CRISPR toolkit into the zygotes. We found a higher editing frequency in 8-cell embryos than in 4-cell embryos, indicating that the CRISPR/Cas9 activity persisted through the 8-cell stage. Analysis of a CRISPR/Cas9 transgenic founder mouse revealed that four different alleles were present in its organs in different combinations and that its germline included three different mutant alleles, as shown by the genotypes of the pups. The indel depth, which measured the extent of indels at the sequence level within single embryos, decreased significantly as the embryos advanced to form ESCs, suggesting that exclusion of fatal indels occurred in the subsequent cell generations. Interestingly, we discovered that the CRISPR sites frequently contained introduced retroelement sequences and that this occurred preferentially with certain classes of retroelements. Therefore, in addition to CRISPR/Cas9’s innate mechanism of separate, differential enzymatic modifications of alleles, the frequent retroelement insertions that occur in early mouse embryos during CRISPR/Cas9 editing further expand the allelic diversity and mosaicism in the resulting transgenic founders.
2019-10-22 | GSE136393 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress