Synthetic construct
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA978267 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR24958300.fastq.gz | Fastqsanger.gz | |||
| SRR24958301.fastq.gz | Fastqsanger.gz | |||
| SRR24958302.fastq.gz | Fastqsanger.gz | |||
| SRR24958303.fastq.gz | Fastqsanger.gz | |||
| SRR24958304.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 8 |
Similar Datasets
Project description:A Functional Group-Guided Approach to Aptamers for Small Molecules
| PRJNA947642 | ENA
Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.
2019-12-31 | GSE137006 | GEO
Project description:Oligonucleotide library Illumina Sequencing of Aptamers
| PRJNA235898 | ENA
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
2019-09-30 | GSE124865 | GEO
Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.
2017-12-20 | E-MTAB-6374 | biostudies-arrayexpress
Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.
2017-12-20 | E-MTAB-6377 | biostudies-arrayexpress
Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.
2017-12-20 | E-MTAB-6375 | biostudies-arrayexpress
Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.
2017-12-20 | E-MTAB-6376 | biostudies-arrayexpress
Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.
2017-12-20 | E-MTAB-6378 | biostudies-arrayexpress
Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.
2017-12-20 | E-MTAB-6380 | biostudies-arrayexpress