Ontology highlight
ABSTRACT:
PROVIDER: PRJNA994591 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR25266944_1.fastq.gz | Fastqsanger.gz | |||
| SRR25266944_2.fastq.gz | Fastqsanger.gz | |||
| SRR25266945_1.fastq.gz | Fastqsanger.gz | |||
| SRR25266945_2.fastq.gz | Fastqsanger.gz | |||
| SRR25266946_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 40 |
Similar Datasets
Project description:The CRISPR-Cas9 system enables efficient sequence-specific mutagenesis for creating germline mutants of model organisms. Key constraints in vivo remain the expression and delivery of active Cas9-guideRNA ribonucleoprotein complexes (RNPs) with minimal toxicity, variable mutagenesis efficiencies depending on targeting sequence, and high mutation mosaicism. Here, we established in vitro-assembled, fluorescent Cas9-sgRNA RNPs in stabilizing salt solution to achieve maximal mutagenesis efficiency in zebrafish embryos. Sequence analysis of targeted loci in individual embryos reveals highly efficient bi-allelic mutagenesis that reaches saturation at several tested gene loci. Such virtually complete mutagenesis reveals preliminary loss-of-function phenotypes for candidate genes in somatic mutant embryos for subsequent generation of stable germline mutants. We further show efficient targeting of functional non-coding elements in gene-regulatory regions using saturating mutagenesis towards uncovering functional control elements in transgenic reporters and endogenous genes. Our results suggest that in vitro assembled, fluorescent Cas9-sgRNA RNPs provide a rapid reverse-genetics tool for direct and scalable loss-of-function studies beyond zebrafish applications.
2016-05-01 | E-MTAB-4143 | biostudies-arrayexpress
Project description:In this study, we aimed at determining RNA interactors of L1TD1 RNPs. To achieve this, DNMT1 KO and DNMT1 L1TD1 DKO HAP1 cells were generated by Crispr/Cas9 gene editing tool and L1TD1 RIP was performed by using these cell lines. Our study reveals a comprehensive analysis of differentially enriched transcripts in L1TD1 containing RNPs.
2025-01-01 | GSE254459 | GEO
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress
Project description:Background. Although several immunotherapies against glioblastoma (GBM) have been investigated for long time, only limited effective results are acquired. Therefore, we developed immunotherapy based on genome edited NK cells knocking out the checkpoint receptor, which would overcome the immunosuppressive tumor microenvironment in GBM. Methods. We generated T cell immunoglobulin and ITIM domain (TIGIT), an inhibitory receptor expressed on lymphocytes, knockout (KO) human primary NK cells using the clustered regularly interspaced short palindromic repeats (CRISPR)/ CRISPR-associated protein9 (Cas9), each single guide RNA targeting different genome sites on TIGIT coding exons. To detect anti-tumor activity of genome edited NK cells against GBM, we utilized 2D adherent model and spheroids derived from GBM cell lines, U87, T98G, LN18, and U251. Subsequently, we performed real time cell growth assays, flow cytometry based apoptosis assays, and ELISA for investigating anti-tumor activity. Result. We established TIGIT KO human primary NK cells using CRISPR/Cas9. Flow cytometry indicated effective knockout of TIGIT and unchanged expression of immune checkpoint receptors other than TIGIT. T7 endonuclease I mutation detection assays showed that RNPs disrupted the intended genome sites. Using real time cell growth assays, we revealed enhanced anti-tumor activity of genome edited NK cells against 2D adherent GBM cells. The genome edited NK cells also exhibits enhanced anti-tumor effect against GBM spheroids derived from GBM cell lines.Conclusion. Our founding suggests that immunotherapy based on TIGIT KO NK cells using CRISPR/Cas9 is a promising therapy against GBM.
2022-09-11 | GSE212941 | GEO
Project description:Analysis of Cas9/sgRNA mutagenic activity at a variety of loci in zebrafish. Each loci has a control, where no Cas9/sgRNA were injected. This is amplicon sequencing with Illumina, after PCR amplification. Data was processed with ampliCan R package version 1.1.1.
2017-12-25 | E-MTAB-6310 | biostudies-arrayexpress
Project description:Analysis of Cas9/sgRNA mutagenic activity at a variety of loci in zebrafish. Each loci has a control, where no Cas9/sgRNA were injected. This is amplicon sequencing with Illumina, after PCR amplification. Data was processed with ampliCan R package version 1.1.1.
2017-12-15 | E-MTAB-6355 | biostudies-arrayexpress
Project description:To obtain a Notch-depleted base cell line into which we could integrate specific ligands or receptors for quantitative analysis of Notch signaling interactions, we conducted 2 rounds of transfection with RNPs (ribonucleoproteins) consisting of gRNAs targeting Notch2 and Jagged1 complexed with Cas9 protein. After antibiotic selection and screening of monoclonal colonies, we obtained the C2C12-Nkd clone, which showed loss of Notch2 protein and Jag1 transcript.
2023-06-02 | GSE233573 | GEO
Project description:Background: Sm proteins are multimeric RNA-binding factors, found in all three domains of life. Eukaryotic Sm proteins, together with their associated RNAs, form small ribonucleoprotein (RNP) complexes important in multiple aspects of gene regulation. Comprehensive knowledge of the RNA components of Sm RNPs is critical for understanding their functions. Results: We developed a multi-targeting RNA-immunoprecipitation sequencing (RIP-seq) strategy to reliably identify Sm-associated RNAs from Drosophila ovaries and cultured human cells. Using this method, we discovered three major categories of Sm-associated transcripts: small nuclear (sn)RNAs, small Cajal body (sca)RNAs and mRNAs. Additional RIP-PCR analysis showed both ubiquitous and tissue-specific interactions. We provide evidence that the mRNA-Sm interactions are mediated by snRNPs, and that one of the mechanisms of interaction is via base pairing. Moreover, the Sm-associated mRNAs are mature, indicating a splicing-independent function for Sm RNPs. Conclusions: This study represents the first comprehensive analysis of eukaryotic Sm-containing RNPs, and provides a basis for additional functional analyses of Sm proteins and their associated snRNPs outside of the context of pre-mRNA splicing. Our findings expand the repertoire of eukaryotic Sm-containing RNPs and suggest new functions for snRNPs in mRNA metabolism.
2013-12-01 | GSE35842 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress