Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Endogenous small RNAs of meristematic and a terminally differentiated tissue of rice.

ABSTRACT: To address the role of small regulatory RNAs in rice development, we generated a large data set of small RNAs from root apices (RoApx), shoot apices (ShApx), developing inflorescence (Infl) and mature leaf (Leaf). These tissues were chosen because they are expected to be rich in small RNAs and display different patterns of small RNA expression. The RoApx, ShApx, and Infl samples are expected to be enriched for meristematic tissues each of which have different fates. The Infl sample would also be expected to contain developing female gametes. In contrast, the Leaf sample is terminally differentiated and may be expected to be more transcriptionally repressed. These small RNAs comprise a total of 781,885 distinct sequences, and all of these map to at least one locus of the rice genome TIGR version 5. Total RNA was extracted from root apices, shoot apices, developing inflorescence and mature leaf. Three samples from each tissue were taken to represent replicates and small RNAs from these were ligated to a common 5' RNA adapter and a replicate-specific 3' adapter. These replicate samples were then identified from within single 454 data sets using the 3' adapter sequence. It should be noted that there was a strong frequency bias observed between the RNA sequence and the particular 3' adapter used in the sequencing. This resulted in both increased or decreased read counts for the known miRNA sequences in a 3' adapter dependent fashion. Use of the three samples for each tissue as replicates is therefore problematic.

ORGANISM(S): Oryza sativa

SUBMITTER: Cameron Johnson

PROVIDER: E-GEOD-16350 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

Clusters and superclusters of phased small RNAs in the developing inflorescence of rice.

Johnson Cameron C Kasprzewska Anna A Tennessen Kristin K Fernandes John J Nan Guo-Ling GL Walbot Virginia V Sundaresan Venkatesan V Vance Vicki V Bowman Lewis H LH

Genome research 20090707 8

To address the role of small regulatory RNAs in rice development, we generated a large data set of small RNAs from mature leaves and developing roots, shoots, and inflorescences. Using a spatial clustering algorithm, we identified 36,780 genomic groups of small RNAs. Most consisted of 24-nt RNAs that are expressed in all four tissues and enriched in repeat regions of the genome; 1029 clusters were composed primarily of 21-nt small RNAs and, strikingly, 831 of these contained phased RNAs and were ...[more]

PMID: 19584097

Similar Datasets

Project description:Maize LEAFBLADELESS1 (LBL1) and Arabidopsis SUPPRESSOR OF GENE SILENCING3 (SGS3) play orthologous roles in the biogenesis of 21 nucleotide trans-acting short-interfering RNAs (tasiRNAs). The phenotypes conditioned by mutation of lbl1 and SGS3 are, however, strikingly different, suggesting that the activities of these small RNA biogenesis components, or the tasiRNAs and their targets might not be entirely conserved. To investigate the basis for this phenotypic variation, we compared the small RNA content between wild-type and lbl1 seedling apices. We show that LBL1 affects all major classes of small RNAs, and reveal unexpected crosstalk between tasiRNA biogenesis and other small RNA pathways regulating miRNAs, retrotransposons, and DNA transposons. We further identified genomic regions generating phased siRNAs, including numerous loci generating 22-nt phased small RNAs from long hairpin RNAs or overlapping antisense transcripts not previously described in other plant species. By combining both analyses, we identified nine TAS loci, all belonging to the conserved TAS3 family. Contrary to other plant species, no TAS loci targeted by a single miRNA were identified. Information from target prediction, RNAseq, and PARE analyses identified the tasiARFs as the major functional tasiRNAs in the maize vegetative apex where they regulate expression of ARF3 homologs. As such, divergence in TAS pathways is unlikely to account for the distinct phenotypes of tasiRNA biogenesis mutants in Arabidopsis and maize. Instead, the data suggests variation in the spatiotemporal regulation of ARF3, or divergence in its function, as a plausible basis for the dramatic phenotypic differences observed upon mutation of SGS3/lbl1 in Arabidopsis and maize. An analysis of tasiRNA biogenesis, activity, and contribution to developmental phenotypes in the maize leaf. Data generated includes small RNA sequencing data and mRNA sequencing data. All data was generated in both wild type and lbl1 mutant maize leaf apices. Three replicates were generated for each genotype for the small RNA data. Two of these replicates were also used for the RNA-seq data.

Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').

Project description:Small RNAs (21-24 nt) are pivotal regulators of gene expression that guide both transcriptional and post-transcriptional silencing mechanisms in diverse eukaryotes, including most if not all plants. MicroRNAs (miRNAs) and short interfering RNAs (siRNAs) are the two major types, both of which have a demonstrated and important role in plant development, stress responses and pathogen resistance. In this work, we used a deep sequencing approach (Sequencing-By-Synthesis, or SBS) to develop sequence resources of small RNAs from different Lactuca sativa tissues (including leaves, flowers, and fungus-infected leaves). The high depth of the resulting datasets enabled us to examine in detail critical small RNA features such as size distribution, tissue-specific regulation and sequence conservation between different organs in this species. We also developed database resources and a dedicated website (http://smallrna.udel.edu/) with computational tools for allowing other users to identify new miRNAs or siRNAs involved in specific regulatory pathways, verify the degree of conservation of these sequences in other plant species and map small RNAs on genes or larger regions of the genome under study. Small RNA libraries were derived from leaves and flowers of Lactuca sativa, cultivar Salinas, including leaves infected with the fungus Bremia lactucae, strain CA-III. Total RNA was isolated using TriReagentÂ® (Molecular Research Center) and submitted to Illumina (Hayward, CA, http://www.illumina.com) for small RNA library construction using approaches described in (Lu et al., 2007) with minor modifications. The small RNA libraries were sequenced with the Sequencing-By-Synthesis (SBS) technology by Illumina. PERL scripts were designed to remove the adapter sequences and determine the abundance of each distinct small RNA. We thank Richard Michelmore and Oswaldo Ochoa for providing the plant material as well as Kan Nobuta for assistance with the computational methods.

Dataset Information

Endogenous small RNAs of meristematic and a terminally differentiated tissue of rice.

Publications

Clusters and superclusters of phased small RNAs in the developing inflorescence of rice.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure