Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Preliminary exploration of Oryza sativa small RNAs - Run 1 and 2

ABSTRACT: The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').

ORGANISM(S): Oryza sativa

SUBMITTER: Cameron Johnson

PROVIDER: E-GEOD-16248 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

Clusters and superclusters of phased small RNAs in the developing inflorescence of rice.

Johnson Cameron C Kasprzewska Anna A Tennessen Kristin K Fernandes John J Nan Guo-Ling GL Walbot Virginia V Sundaresan Venkatesan V Vance Vicki V Bowman Lewis H LH

Genome research 20090707 8

To address the role of small regulatory RNAs in rice development, we generated a large data set of small RNAs from mature leaves and developing roots, shoots, and inflorescences. Using a spatial clustering algorithm, we identified 36,780 genomic groups of small RNAs. Most consisted of 24-nt RNAs that are expressed in all four tissues and enriched in repeat regions of the genome; 1029 clusters were composed primarily of 21-nt small RNAs and, strikingly, 831 of these contained phased RNAs and were ...[more]

PMID: 19584097

Similar Datasets

Project description:ABSTRACT: Exposure to abiotic stresses triggers global changes in the expression of thousands of eukaryotic genes at the transcriptional 70 and post-transcriptional levels. Small RNA (smRNA) pathways and splicing both function as crucial mechanisms regulating stress-responsive gene expression. However, examples of smRNAs regulating gene expression remain largely limited to effects on mRNA stability, translation, and epigenetic regulation. Also, our understanding of the networks controlling plant gene expression in response to environmental changes, and examples of these regulatory pathways intersecting, remains limited. Here, to investigate the role of smRNAs in stress responses we examined smRNA transcriptomes of Brachypodium distachyon plants subjected to various abiotic stresses. We found that exposure to different abiotic stresses specifically induced a group 75 of novel, endogenous small interfering RNAs (stress-induced, UTR-derived siRNAs, or sutr-siRNAs) that originate from the 3M-bM-^@M-2 UTRs of a subset of coding genes. Our bioinformatics analyses predicted that sutr-siRNAs have potential regulatory functions and that over 90% of sutr-siRNAs target intronic regions of many mRNAs in trans. Importantly, a subgroup of these sutr- siRNAs target the important intron regulatory regions, such as branch point sequences, that could affect splicing. Our study indicates that in Brachypodium, sutr-siRNAs may affect splicing by masking or changing accessibility of specific cis-elements 80 through base-pairing interactions to mediate gene expression in response to stresses. We hypothesize that this mode of regulation of gene expression may also serve as a general mechanism for regulation of gene expression in plants and potentially in other eukaryotes. Analysis of smRNA populations in Brachypodium plants challenged by abiotic stresses: To profile the populations of smRNAs in the model monocot Brachypodium distachyon and examine their regulation in response to abiotic stresses, we conducted high-throughput sequencing of small RNAs from plants exposed to four different abiotic stress conditions, cold, heat (air), heat (water immersion), and salt, in the wild type Brachypodium cultivar Bd21. For our experiments we used information from the literature to select two time-points for stress durations, short and long, which differed for each stress: cold (6 and 24 hours), heat-air (1 and 3 hours), heat-water (1 and 3 hours), and salt (48 hours). We generated small RNA libraries for Illumina sequencing (GAII) from the leaves of Brachypodium plants subjected to stresses and selected smRNAs between 15 and 40 nt in length, which we mapped to the Brachypodium genome.

Project description:Whole genome shotgun bisulfite sequencing, small RNA sequencing and transcriptome sequencing of wildtype Arabidopsis plants (Col-0), and met1, drm1 drm2 cmt3, and ros1 dml2 dml3 null mutants using the Illumina Genetic Analyzer. A comparison was performed with regions of the genome containing cytosine DNA methylation identified by methylcytosine immunoprecipitation and whole-genome oligonucleotide tiling microarrays, for wildtype Col-0. Understanding the epigenetic regulatory mechanisms that mediate control of transcription at multiple levels is critical to understanding how plants develop and respond to their environment. We combined next-generation sequencing by synthesis (SBS) technology with novel methods for direct sequencing of the entire cytosine methylome (methylC-seq), transcriptome (RNA-seq), and the small RNA component of the transcriptome (smRNA-seq) to create a set of highly integrated epigenome maps for Arabidopsis thaliana, in conjunction with a set of informative mutants defective in DNA methyltransferase and DNA demethylase activity. At single-base resolution we discovered extensive, previously undetected, DNA methylation, identified the context and level of methylation at each site, and found that local composition has effects upon DNA methylation state. Deep sequencing of the smRNAome exposed a direct relationship between the location and abundance of smRNAs and DNA methylation, perturbation of smRNA biogenesis upon loss of CpG DNA methylation, and a tendency for smRNAs to direct strand-specific DNA methylation in the region of RNA-DNA homology. Finally, strand-specific RNA-seq revealed changes in the transcript abundance of hundreds of genes upon alteration of the DNA methylation state, and enabled the identification of numerous previously unidentified genes regulated by DNA methylation. Keywords: Whole genome shotgun bisulfite sequencing, small RNA sequencing, transcriptome sequencing, methylcytosine immunoprecipitation, whole-genome oligonucleotide tiling microarrays Whole genome shotgun bisulfite sequencing, small RNA sequencing and transcriptome sequencing of wildtype Arabidopsis plants (Col-0), and met1, drm1 drm2 cmt3, and ros1 dml2 dml3 null mutants using the Illumina Genetic Analyzer. A comparison was performed with regions of the genome containing cytosine DNA methylation identified by methylcytosine immunoprecipitation and whole-genome oligonucleotide tiling microarrays, for wildtype Col-0.

Dataset Information

Preliminary exploration of Oryza sativa small RNAs - Run 1 and 2

Publications

Clusters and superclusters of phased small RNAs in the developing inflorescence of rice.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure